Diagcor Bioscience Incorporated Ltd v. Chan Wai Hon Billy and Others

Case No.HCIP 27/2022[2026] HKCFI 488
Court
High Court CFI
Date22 Jan 2026
Judge
Case Document
100%

HCIP 27/2022

[2026] HKCFI 488

IN THE HIGH COURT OF THE

HONG KONG SPECIAL ADMINISTRATIVE REGION

COURT OF FIRST INSTANCE

INTELLECTUAL PROPERTY PROCEEDINGS NO. 27 OF 2022

(TRANSFERRED FROM ACTION NO. 2107 OF 2012)

____________

BETWEEN

  DIAGCOR BIOSCIENCE INCORPORATED Plaintiff
  LIMITED (達雅高生物科技有限公司)  
  and  
  CHAN WAI HON BILLY (陳為瀚) 1st Defendant
  CHAN RHYS CHEUK YU (陳卓宇) 2nd Defendant
  FANG TZE KAM (范紫琴) 3rd Defendant
  LAM YEE KWAN (林綺君) 4th Defendant
  TANG KAI MAN (鄧佳文) 5th Defendant
  CHUNG CHI MAN (鐘志文) 6th Defendant
  TO WAI LUEN (杜緯綸) 7th Defendant
  ACECGT (HOLDINGS) LIMITED 8th Defendant
  ACECGT DIAGNOSTIC LIMITED 9th Defendant
  ACECGT LIFE SCIENCE LIMITED 10th Defendant
  DNA LABORATORY LIMITED 11th Defendant

__________

Before: Hon Lok J in Court
Dates of Trial: 9-10 April, 20-24, 27-31 May, 3-6, 18-21, 24-25 June, 15 July 2024
Date of Judgment: 22 January 2026

____________________

JUDGMENT

____________________

1.This is a claim by the Plaintiff against 5 of its former employees (the 1st to 5th Defendants) and closely related persons (the 6th and 7th Defendants) who allegedly misused the Plaintiff’s confidential and proprietary information pertaining to a prenatal genetic gender test in the setting up and operation of a rival business (the 8th to 10th Defendants) back in 2012. In the short space of less than two months, their rival business was up and running, offering essentially the same prenatal genetic test to the public (“the Defendants’ Y-Test”).

2.On the other hand, the Defendants claim that, though 1st, 2nd and 4th Defendants had access to the confidential information of the Plaintiff relating to, inter alia, the genetic markers for the conduct of the Plaintiff’s test (“the Plaintiff’s Y-Test”), they did not take away or use such confidential information in developing the Defendant’s Y-Test. The Defendants, in particular the 2nd Defendant, independently developed and validated the Defendant’s Y-Test in that period of time.

3.The Plaintiff does not accept that the Defendants had independently developed the Defendant’s Y-Test. The Plaintiff contends that the Defendants actually used the markers of the Plaintiff (“the Plaintiff’s Markers”) in developing the Defendants’ Y-Test. The markers disclosed by the Defendants for the conduct of the Defendant’s Y-Test (“the Defendants’ Markers”) were not actually the ones used by them. But even based on the Defendants’ Markers, the Plaintiff claims that:

(i)  the Defendants’ Y-Test bears strikingly similar features to the Plaintiff’s Y-Test in the choice of genetic markers;

(ii)  the Defendants’ disclosure also reveals that the so-called validation done by them was woefully deficient;

(iii)  the only reason why the Defendants were confident to launch the Defendants’ Y-Test with so little or even no validation done is because they knew full well that it was copied from the Plaintiff’s Y-Test.

4.The respective lists of the Plaintiff’s Markers and the Defendants’ Markers are included in Annexes 1 and 2 of this Judgment.

5.This is the main claim of the Plaintiff, and I would refer this as “the Confidential Information Claim”. There is also another negligence claim against specifically the 3rd Defendant. The Plaintiff’s claims that the 3rd Defendant, whilst working as the Associate Laboratory Manager for the Plaintiff, was negligent in issuing two reports on thalassemia tests relating to the Plaintiff’s clients. In this Judgment, I would refer this as “the Negligence Claim”.

6.There is an order on split trial on liability and quantum[1], and this is the trial on liability. In the course of the trial, the Plaintiff has decided to drop the other pleaded claims against the Defendants, which include: (i) the claim for infringement of copyright works by the 8th to 11th Defendants; (ii) the claim for willful default against the 3rd Defendant in respect of the two reports on thalassemia tests; (iii) the claim for breach of confidence against the 5th Defendant in relation to Plaintiff’s list of clientele and contact details of source of referrals; (iv) the claim for procurement of breach of contract by the 1st, 4th, 6th and 7th Defendants; (v) the claim for wrongful solicitation of Diagcor’s former employees against the 1st and 4th Defendants; and (vi) the claim for conspiracy to injure against all the Defendants.

A.  BACKGROUND

7.The Plaintiff, Diagcor Bioscience Incorporation Limited (“Diagcor”), is a biotechnology company established in March 2006. Over the past 18 years, Diagcor has been carrying out research and development (“R&D”) on bio-medical diagnostic products and services, and providing molecular diagnostic laboratory services in Hong Kong. In this Judgment, I would use the term “Plaintiff” and “Diagcor” inter-changeably depending on the context.

8.One of the main types of Diagcor’s laboratory services is prenatal testing for pregnant women. Relevant to this case are prenatal tests for:

(i)  identification and prediction of foetal gender (“Y-Test”); and

(ii)  detection and diagnosis of the genetic disorders Alpha-Thalassemia (“Alpha-Test”) and Beta-Thalassemia (“Beta-Test”).

9.Dr Joseph Tam Wing On (“Joseph”) was one of Diagcor’s founders. No one disputes the impressive academic and professional records of Joseph.

10.Upon Joseph’s retirement from the University of Hong Kong, he initiated the formation of some local biotech companies, where he worked on a part-time basis. One example was Medical Gene Center Limited (“MGC”), established in 2002 upon Joseph’s suggestion, which provided testing services and developed DNA detection products. As it happened, the 1st to 4th Defendants also worked together with Joseph at MGC.

11.In around 2005, Joseph and MGC’s management had a major disagreement over the future development and funding arrangements of MGC. He therefore resigned from all duties with effect from 16 November 2005.

12.After this, Joseph and another genetic expert, Mr Anthony Wong (“Anthony”), formed Diagcor in around March 2006. Joseph then served as the Chief Executive Officer (“CEO”) of Diagcor from June 2006 to 31 March 2009 and from November 2011 to 31 July 2017. He was also the Chairman and Chief Scientific Officer until his retirement in May 2019. Since then, Joseph had served as Diagcor’s non-executive Honorary Chairman.

13.When Diagcor’s business first started, the provision of Down Syndrome DNA and cytogenetic tests (which involved the use of invasive methods) was the major source of its revenue. From around December 2006, Diagcor focussed on developing the first generation (“Gen 1”) of the Diagcor’s Y-Test (which involved the use of a non-invasive method) using a collection of multiple genetic markers on the Y-chromosome (instead of a single Y-marker as reported in literature). It was launched in the market in around April 2007. According to Diagcor, it was then the first and only non-invasive prenatal test in the world that could claim 92-98% accuracy for a routine application.

14.In the next section on technical primer, I will explain the meaning of genetic markers and how the tests using such markers would help to find out the gender of the foetus and the likelihood of the baby getting certain diseases.

15.Ms Chu Lai On (“Chu”), Diagcor’s then Assistant R&D Manager, was responsible for the R&D of Gen 1 of the Plaintiff’s Y-Test under Joseph’s supervision. Chu was one of Diagcor’ witnesses at the trial.

16.In around early 2011, Diagcor embarked on the R&D of the second generation (“Gen 2”) of the Plaintiff’s Y-Test with, inter alia, improvement in its throughput and sensitivity. A collection of 15 Y-markers were chosen for use in Gen 2.

17.There is no dispute that Diagcor achieved great business success from the Y-Test. According to Diagcor, from 2008 to 2012, over 90% of Diagcor’s income came from the Y-Test. The market demand for the Plaintiff’s Y-Test was very strong and needed almost no promotion, especially given the then social background that large numbers of Mainland pregnant women came to Hong Kong to give birth to their babies.

18.The Defendants consist of a group of Diagcor’s former employees, their related persons, and companies formed by some of them in around the summer of 2012. As mentioned above, the 1st to 4th Defendants had a long-standing relationship with the Diagcor and Joseph, which dates to at least the early 2000s when they were working at MGC.

19.The 1st Defendant, Mr Chan Wai Hon Billy (“Billy”) is a scientist who obtained a PhD in Biochemical Sciences. He also obtained an MBA. Billy joined Diagcor on 1 September 2006 and was employed there until 16 May 2012. Billy served as Diagcor’s Chief Operating Officer (“COO”), President, and CEO at different points in time.

20.Like Billy, the 2nd Defendant, Mr Chan Cheuk Yu Rhys (“Rhys”), was also trained as a scientist. Rhys obtained a bachelor’s degree in Biology at Hong Kong University of Science and Technology (“HKUST”) in 2003. He was under Diagcor’s employment from 16 May 2006 to 16 July 2012. Rhys initially served as Research Scientist, and later as Production Officer, Acting Assistant Production Manager and Information Technology Officer at different points in time.

21.The 3rd Defendant, Ms Fang Tze Kam also known as Ms Maggie Fang (“Maggie”), is another scientist who studied at HKUST where she obtained a bachelor’s degree in Biochemistry in 1999 and a master’s degree in Environmental Science in 2000. Diagcor hired Maggie in July 2006 when it first launched its services. From 3 July 2006 to 27 July 2012, Maggie served as Diagcor’s Medical Laboratory Technologist (“MLT”), Assistant Laboratory Manager, and Associate Laboratory Manager at different times. In around January 2007, Maggie qualified as an MLT in Part II of the Register of Medical Laboratory Technologies (“MLT-II”). Subsequently, through post-qualification working experience gained from working for Diagcor, Maggie was admitted to the higher grade of Part I of the Register of Medical Laboratory Technologies (“MLT-I”) in around June 2011.

22.The 4th Defendant, Ms Lam Yee Kwan also known as Ms Peggy Lam (“Peggy”), despite not being a scientist, was the first employee hired by Diagcor. Peggy started with Diagcor as Administrative Officer on 15 May 2006 and was tasked to look for Diagcor’s laboratory premises. Peggy was later promoted to Assistant Administrative Manager and to Administrative Manager. From 1 April 2011 up to her last working day on 19 July 2012, Peggy was Diagcor’s Corporate Manager.

23.The 5th Defendant, Mr Tang Kai Man (“Tang”), studied Applied Biology at City University. He served as Diagcor’s Sales Executive (Diagnostic Service) from 3 May 2011 to 5 September 2012.

24.The 6th Defendant, Mr Chung Chi Man also known as Terry Chung (“Terry”), graduated with a bachelor’s degree in General Arts. In April 2009 when Terry was still employed by One Solution Limited (“OSL”), he came to know Rhys, who recommended OSL to be Diagcor’s information technology service provider in late 2010. Thereafter, Terry paid routine visits to Diagcor’s premises to provide services in the course of OSL’s employment.

25.The 7th Defendant, Mr To Wai Luen also known as Mr Alan To (“Alan”), is Maggie’s husband.  He studied Physics at university. After graduation, he worked as an insurance agent and financial advisor.

26.Unlike the other personal Defendants, neither Terry nor Alan had a bioscience background or any experience in the biotechnology industry. Yet, they jointly ventured into the molecular biology laboratory business in the summer of 2012 through four Hong Kong companies, i.e. AceCGT (Holdings) Ltd (the 8th Defendant, referred to as “AceCGT Holdings”), AceCGT Diagnostic Ltd (the 9th Defendant, referred to as “AceCGT Diagnostic”), AceCGT Life Science Ltd (the 10th Defendant, referred to as “AceCGT Life Science”), DNA Laboratory Ltd (the 11th Defendant, referred to as “DNA Laboratory”) and one BVI company, i.e. Possible Legend Limited (“PLL”). I refer the 8th to 11th Defendants collectively as “the Corporate Defendants”.

27.Soon after the termination of Billy’s employment with  Diagcor on 16 May 2012:

(i)  Billy has taken up the roles of AceCGT Diagnostic’s Director and AceCGT Life Science’s President;

(ii)  Rhys left  Diagcor and was employed as Technical Officer of AceCGT Diagnostic and Business Development Manager of the Corporate Defendants;

(iii)  Maggie left Diagcor and became AceCGT Diagnostic’s Laboratory Consultant and DNA Laboratory’s Director;

(iv)  Peggy left Diagcor and became AceCGT Diagnostic’s COO and DNA Laboratory’s Director;

(v)  Tang left Diagcor and became DNA Laboratory’s Sales Manager;

(vi)  the following technicians left Diagcor and joined the Corporate Defendants:

(a)  Ms Constance Lo (“Constance”) became AceCGT Diagnostic’s Assistance Laboratory Manager;

(b)  Ms Priscilla Lo became AceCGT Diagnostic’s Laboratory Officer;

(c)  Mr Justin Wong (“Justin”) became DNA Laboratory’s Science Laboratory Officer;

(d)  Ms Trista Ng (“Trista”) became DNA Laboratory’s Laboratory Technician; and

(e)  Ms Clara Chan became DNA Laboratory’s Laboratory Assistant.

28.Within less than a month of DNA Laboratory’s incorporation on 13 August 2012, DNA Laboratory launched the Defendants’ Y-Test in September 2012 and claimed to achieve over 99% accuracy. On 12 September 2012, DNA Laboratory issued its first report for the Defendants’ Y-Test, entitled “Maternal DNA Test Report”. Within the next two weeks, DNA Laboratory issued no fewer than 100 similar reports.

29.The Confidential Information Claim is the main claim. Despite the length of this trial and the complexity of the evidence, the issue in the present case is a simple one: whilst Billy, Rhys and Peggy (and possibly Terry) could have had access to the confidential information about the Plaintiff’s Y-test (“the Confidential Information”), did the Defendants indeed obtain the Confidential Information and use such information in developing the Defendants’ Y-Test? Or did the Defendants in fact develop the Defendants’ Y-Test by themselves (in particular in the way as described by Rhys) without using the Confidential Information?

30.For the purpose of the Confidential Information Claim, the Confidential Information relied on by Diagcor includes: (i) the identity of 15 Y-markers and 1 X-marker; (ii) the primer and probe sequences of these 15 Y-markers and 1 X-marker; (iii) the primer and probe validation data obtained in the development and modification of the Plaintiff’s Y-Test; (iv) the primer and probe sequences used in the development and modification of the Plaintiff’s Y-Test; and (v) the experimental protocols of the Plaintiff’s Y-Test. Diagcor also claims that it has copyright on the Confidential Information.

31.Another claim is the Negligence Claim, which relates to two testing incidents involving the respective Alpha-Test and Beta-Test. The first incident occurred in December 2011 (“the Alpha-Test Incident”) and the second incident occurred in May 2012 (“the Beta-Test Incident”). Before I deal with the details of the Negligence Claim, I will set out the technical facts about this case.

B.  TECHNICAL FACTS

32.This case mainly concerns the Y-test which is used to find out the gender of the foetus and whether the baby is suffering from any genetic diseases. In this regard, I have asked Diagcor to prepare a technical primer relating to this case. There is no serious dispute about the technical facts in the primer which are set out below.

B.I  What is DNA?

33.The human body consists of organs responsible for performing different functions. Organs are made up of structural units known as cells.

34.Vital to cellular structure and bodily functions are large chemical molecules called proteins. Proteins are made up of chains of building blocks known as amino acids, of which there are 20 types. These chains of amino acids must fold into the correct shape for proteins to function properly.

35.Proteins are manufactured inside a cell. Instructions for making proteins are stored within cellular structures known as chromosomes. There are a total of 23 pairs of chromosomes in each human cell: 22 pairs of non-sex chromosomes (autosomes) and 1 pair of sex chromosomes (which determines gender). The two arms in each pair of chromosomes are derived respectively from a person’s father and mother. Therefore, chromosomes are hereditary materials that pass from parents to their next generation.

36.The precise part of a chromosome storing instructions for making proteins are chemicals called deoxyribonucleic acid (“DNA”). DNA is made up of two interwinding strands of base subunits that pair up and wind into a double helix. There are 4 types of these subunits: Adenine (“A”), Cytosine (“C”), Guanine (“G”) and Thymine (“T”). It is the exact sequence of subunits that records the instructions for making proteins. These instructions are then decoded by intracellular processes known as transcription and translation.

37.One feature of DNA is the phenomenon of sequence complementarity. This means when two DNA strands pair up, “A” always binds with “T”, “C” always binds with “G”. These are also known as A:T base pairs and C:G base pairs. Because of this complementarity, one can derive the sequence of both strands of DNA from the sequence of only one of the strands. For example, if one knows that the sequence of one strand is “ATCG”, the sequence of the opposite strand will be “TAGC”, as “A” pairs up with “T” and “C” pairs up with “G”.

38.The human genome runs to billions of DNA bases. Scattered across the genome are discrete DNA segments called genes. Genes at different chromosomal locations are responsible for encoding different proteins. Genes coding for the same protein may exist in different versions across humans. These different versions are known as alleles. A person may have inherited the same allele, or different alleles, of these genes from his or her two parents. Where a person has inherited the same allele from each parent, he or she is homozygous with respect to that gene. Where that person has inherited different alleles, he or she is heterozygous with respect to the gene.

B.II  Genetic diseases, screening and diagnosis

39.Given that genes dictate the making and functioning of proteins, aberrations in one’s genomic sequence (e.g. DNA mutations) could cause an individual to suffer genetic diseases. Genetic diseases can be either sex-chromosome (X/Y) linked, or autosomal/non-sex chromosome (1-22) linked.

40.As genetic diseases are inherited, the existence of the disease in a foetus may be detected by way of prenatal testing even before the birth of the baby. Testing methods are broadly divided into “screening” and “diagnostic” tests:

(i)  Screening tests: these are non-invasive and safe in that they do not involve the direct sampling of foetal cells from the womb. However, they are less definitive and only serve as a screen to identify whether the baby is at a higher risk of certain genetic diseases.

(ii)  Diagnostic tests: these are more definitive as they involve direct sampling of foetal cells by chorionic villus sampling (“CVS”; 1st trimester) or amniocentesis (2nd trimester). Despite this, due to the risk of foetal loss or birth defects by using these methods, they are only used when the baby is tested positive in a prenatal screen.

41.Traditional prenatal screening tests include: (i) the maternal serum screen (“MSS”, which detects hormones in maternal blood); (ii) ultrasound measurement of nuchal translucency (“NT”, which measures the baby’s head); and (iii) the MSS/NT combined test. These tests have been performed routinely for many decades. However, their sensitivity is relatively limited (70-90%), and the false positive rate is not negligible (5%).

42.A breakthrough came in 1997 when it was discovered that a small amount of cell-free foetal DNA (“cffDNA”) is present in the blood of a pregnant mother, and cffDNA would become undetectable within hours after the birth of the baby. This has enabled the prenatal screening for genetic diseases by testing cffDNA during pregnancy by simply taking the pregnant mother’s blood. Such testing has resulted in higher sensitivity (close to 100%) and lower false positive rates (close to 0%) than traditional prenatal screening methods, and has become a key testing component in real-life clinical setting.

B.III  What are genetic markers?

43.A genetic marker is a DNA sequence situated in a specific genomic region or location known to contain natural variations between individuals. By virtue of the existence of these variations (polymorphisms), genetic markers may be used to identify individuals who have a higher risk of diseases, or to infer relationships and shared ancestry between individuals.

44.Different types of genetic markers exist. Relevant to this Action are:

(i)  Short tandem repeats (“STR”): short, repeated DNA sequences that vary in the number of repeats between individuals.

(ii)  Single nucleotide polymorphisms (“SNP”): these involve a single nucleotide change in the relevant DNA sequence. There are millions of SNPs scattered throughout the human genome. SNPs contribute to genetic diversity among individuals and populations.

45.In this Judgment, I will refer to regions of the human genome where STR markers are present as “STR regions” collectively, and regions where SNP markers are present as “SNP regions” collectively.

B.IV   How are genetic markers detected?

46.Laboratory techniques are available to detect a person’s genetic variations at the genetic marker of interest. There are various techniques, but 3 methods are particularly relevant to the dispute in this Action: (i) SSLP (simple sequence length polymorphisms) Typing; (ii) real-time PCR (polymerase chain reaction); and (iii) DNA sequencing.

47.Given that all these 3 methods normally require the use of PCR at a certain stage, I have to first explain what the PCR is and how it is usually performed:

(i)  The PCR is a widely used molecular biology technique by which one can detect and make many copies of (i.e. amplify) a target DNA segment from a sample. If the sample contains the target DNA, the DNA segment would be amplified (i.e. the “amplicon”). If the sample does not contain the target DNA, nothing would normally be amplified.

(ii)  The most important component for a successful PCR is synthetic, single-stranded oligonucleotides known as “primers” which flank the target DNA segment. One primer is needed to target the sequence at the 5’-end of the DNA segment (i.e. the beginning). Another primer is needed to target the sequence at the 3’-end of the segment (i.e. the end). Specificity of the primers is key – they must not bind to any other part of the human genome, for if they do, there would be non-specific binding and amplification and the PCR will not serve its purpose. After mixing the sample and primers (plus other necessary ingredients), the reaction proceeds by repeated cycles of denaturation, annealing and extension. This is normally done on machines called thermocyclers, which are programmed to set the optimal denaturation, annealing and extension temperatures, and the durations in each cycle.

(iii)  To detect whether the PCR has amplified the target DNA segment in the PCR product (and hence whether the sample in fact contains the target segment), two types of detection methods are generally used:

(a)  End-point detection: as its name suggests, this type of detection only takes place at the end of a PCR. The most common example is electrophoresis, either on an agarose gel (gel electrophoresis) or in a liquid-filled glass capillary (capillary electrophoresis). In electrophoresis, DNA is first extracted from the PCR product and then its size separated by an electrical voltage on a gel or in a capillary. Since DNA is negatively charged, any amplified DNA segments would run towards the positive end of the electrophoresis instrument. As smaller DNA segments run faster than larger segments, any amplified DNA may be separated by size. The exact size of any amplicons can then be ascertained by running a mixture of DNA segments of known sizes (called DNA standards or DNA ladders) at the same time. While electrophoresis provides size information of any amplicons in the PCR product (i.e. sequence length in base pairs, bps), it gives no quantitative information (e.g. in nanograms).

(b)  Real-time detection: on the other hand, real-time PCR methods continuously monitor and detect the presence of any amplicons as the PCR progresses. This may be achieved by two ways:

(1)  A free-floating fluorescent dye known as “SYBR Green” is added in the PCR mix. This dye binds to double-stranded DNA and increases in fluorescence when bound to such DNA. When the primers bind to target DNA in a PCR and successful amplification occurs, the fluorescence emitted by the dye bound to double-stranded DNA may be detected.

(2)  Alternative to SYBR Green, one can add “probes” (also known as “Taqman probes”) in the PCR mix. Like primers, probes are synthetic, single-stranded oligonucleotides that target a specific sequence in the target DNA segment. But instead of binding to the 5’- and 3’- ends of the target, probes bind somewhere in between. Moreover, probes have a fluorescent label attached to them on one end. When the primers and probes bind to target DNA and successful amplification occurs in the PCR, the fluorescent label gets released, emitting a fluorescence signal that can be detected.

Regardless of whether SYBR Green or probes is used, as more and more amplicons are generated in further PCR cycles, the fluorescence intensifies. It is the measurement of that fluorescent signal (if any) that enables quantitative information on the amount of amplicon to be measured. While real-time PCR provides quantitative information on any amplicons present in the PCR product, it provides no size information on amplicons. Real-time PCR may be conducted on standard real-time platforms that take 96 samples, or high-throughput platforms like Fluidigm which enables a much larger number of samples to be tested at the same time.

48.With the principles of PCR explained, I now turn to the 3 methods mentioned in §46 above.

49.SSLP Typing may be used to detect STR markers. As discussed above, variations in STR markers lie in the number of tandem repeats in a short DNA sequence. In order to detect which allele is present in a DNA sample from a person, one can: (i) design primers that target the STR marker; (ii) run the PCR to amplify the marker; and (iii) analyze the PCR product using electrophoresis to see whether it is the larger size amplicon or the smaller amplicon that has been amplified in the PCR, and hence present in the sample.

50.Real-time PCR may be used to detect SNP markers. To do so, one can design primers with a 3’-end which matches the specific nucleotide at the SNP position of interest. Only samples with a particular SNP nucleotide would result in amplified DNA, whereas samples without the particular SNP nucleotide would not be amplified. In theory, standard PCR may also be done by using the same set of primers. But real-time PCR has the benefit of real-time detection of PCR products, thus saving the time needed to carry out a separate, post-reaction step of gel or capillary electrophoresis of the PCR product that would be required in a standard PCR. Furthermore, where a real-time PCR is run with a probe, amplification specificity can be enhanced. This is because, in standard PCR, amplification already occurs with the binding of two primers on the target DNA. Such binding may in some cases be not perfectly specific and yet amplification can still occur (i.e. false positive). However, in real-time PCR, amplification and fluorescent detection only occurs with the binding of two primers and one probe on the same target. The requirement for the probe to bind further to the binding of primers makes real-time PCR with the use of probes more specific.

51.DNA sequencing may also be used to detect SNP markers as it enables the precise sequence of a DNA sample to be ascertained. DNA sequencing techniques depend on the use of PCR to amplify the DNA region of interest from a sample. Hence, one would first design primers that flank the DNA segment to be sequenced. The inclusion of special nucleotides in the PCR mix enables the exact sequence of the amplicon to be read, detected, and shown in the form of a graph with different coloured peaks. By sequencing DNA from samples of different individuals, one can therefore detect whether any variations are present in the target marker and ascertain the exact variations.

B.V  Y-tests

52.As mentioned above, the human genome comprises 22 pairs of non-sex chromosome and 1 pair of sex-chromosome. Males have sex chromosomes of X and Y. Females have sex chromosomes of X and X. It is therefore possible to detect whether a sample contains male or female DNA by detecting the presence of Y-chromosome. Such tests are generally called “Y-tests”.

53.To detect whether a sample contains male DNA, one can use the PCR due to its ability to detect and amplify specific target DNA segments from a sample. Primers can be designed to target DNA markers that are only present in the Y-chromosome but not in the X-chromosome (or anywhere else in the genome). If an amplicon is generated, the sample is likely to be from a male (and vice versa). Given the presence of cffDNA in a pregnant mother’s blood, PCR may be performed on maternal blood as part of non-invasive prenatal testing.

54.Various Y-specific genetic markers may be used as the target in a Y-Test, the choice of which depends on its exact purpose. If one is only interested in pure gender determination (i.e. to tell whether the baby is a boy or a girl), one can simply detect the SRY gene that is uniquely present in the Y-chromosome. SRY is the vital gene that confers the male gender in humans.

55.On the other hand, if one wants to go beyond pure sex determination into paternal lineages (for example: to prove whether the baby is that of the husband), or identify shared ancestry, one can resort to markers with more natural variations on the Y-chromosome such as STRs or SNPs. The detection of similar variations present in the cffDNA sample and present in the sample of interest (i.e. the father) infers paternal lineages and shared ancestry.

B.VI  Thalassemia Tests

56.The following technical facts are relevant to the Negligence Claim involving the conduct of the Alpha-Test and Beta-Test.

57.One major function of human blood is to carry oxygen, through red blood cells, to different organs. The essential component within red blood cells comprises two forms of the globin proteins which are called alpha-globin and beta-globin. Mutations in the alpha-globin and beta-globin genes result in inherited blood disorders called alpha-thalassemia and beta-thalassemia, which can be fatal.

58.The most common cause of alpha-thalassemia is deletion mutations within the alpha-globin genes. Patients with alpha-thalassemia may have different extents of deletion in their global genes. Since alpha-globin genes with one or more deletions (compared to the wildtype) are smaller in size, the prenatal testing of alpha-thalassemia can be achieved by performing PCR on a foetal DNA sample using a pair of alpha-globin gene specific primers flanking the deletion region, and analyzing the PCR product by gel electrophoresis. Amplicons from samples with deletion mutation alleles will run faster on the agarose gel and can therefore be identified. This is the Alpha-Test.

59.On the other hand, beta-thalassemia is commonly caused by point mutations affecting the beta-globin gene. Point mutations refer to the fact that the DNA base at certain positions of the beta-globin gene have mutated from the wildtype base. These point mutations may be detected by using PCR to amplify the relevant parts of the beta-globin gene and performing DNA sequencing. This is the Beta-Test.

60.With the technical facts explained, I now turn to the witnesses at the trial.

C.  WITNESSES AT THE TRIAL

C.I  The factual witnesses in support of the Plaintiff’s case

61.Joseph, Chu and Ms Lee Hui Kwan Rebecca (“Rebecca”) testified on behalf of Diagcor’s case.

62.Joseph gave the court an account of, inter alia: (i) the history of his relationship with Billy, Rhys, Maggie and Peggy dating back to the days when they were working at MGC in the early 2000; (ii) the demand for Y-Test in Hong Kong in the late 2000s and early 2010; (iii) the importance of the accuracy of a Y-Test; and (iv) facts leading to the dispute in this Cction including the deterioration of his relationship with some of the Defendants in particular Billy.

63.Joseph also told the court how evasive that the Defendants were when they were first asked to provide the details about the markers used by them to develop the Defendants’ Y-Test. He believed that the Defendants’ Markers eventually disclosed by the Defendants were not the actual ones used by them in around July and August 2012. He also told the court as to why he believed that the Defendants could not have developed the Defendants’ Y-Test within such a short period of time.

64.Mr Ng, counsel for the Defendants, makes submissions in length to attack the credibility of Joseph’s evidence. He submits that: (i) Joseph was evasive when he was asked about Billy’s position in Diagcor; (ii) Joseph lied about Billy’s habit of copying company information, Billy’s and Rhys’ involvement in developing the Plaintiff’s Y-Test, Maggie and Terry having knowledge of the Confidential Information including sequences, and Maggie and Tang having stolen doctor’s list; (iii) Joseph only suspected of other people having a conspiracy against him because he was the kind of person who had conspired to injure the interest of his former employer MGC; (iv) Joseph was adopting double standards when he was comparing the Plaintiff’s and the Defendants’ Y-Tests; (v) Joseph made false allegations against the Defendants about creating conflicts among the laboratory staffs of Diagcor; (vi) Joseph had exaggerated the time taken and the complexity for the development of both generations of the Plaintiff’s Y-Test; (vii) Joseph was wrong in saying that there was gold or high standard for the development of a Y-Test; (viii) Joseph had exaggerated Diagcor’s claim by saying that the Defendants had used SNP in developing the Defendants’ Y-Test; (ix) Joseph had been dishonest in not revealing to the court that the possibility of overlap or close proximity of the Defendants’ Markers with the Plaintiff’s Markers could be the result of literature research; (x) the sequence comparison table supplied by Joseph was untrue; (xi) Joseph wrongly relied on the allegation that the same number of markers were used in both the Plaintiff’s Y-Test and the Defendants’ Y-Test as the basis for Diagcor’s complaint for copying as stated in the original pleading (the Plaintiff’s Y-Test used 13 markers whereas the Defendants’ Y-Test used 15 markers); (xii) Joseph made a wrong accusation against the Defendants that they had changed from 500 bp (basepairs) to 200 bp in respect of the Defendants’ disclosed Markers; (xiii) Diagcor had shifted its case from one of drawing inference for stealing or copying of the Confidential Information to one based on smokescreen theory or springboard theory; and (xiv) Joseph invented that there was a “special relationship” (implying having a romantic affair) between Billy and Peggy.

65.To me, Joseph is an opinionated person who firmly believes in the integrity and novelty of the Plaintiff’s Y-Test. He might have exaggerated certain parts of Diagncor’s claim, and he might be paranoid about a possible plot by the Defendants against Diagcor. However, all these matters do not destroy the credibility of his evidence that the Plaintiff’s Markers and their associated primer and probe sequences are confidential information which the Defendants were not entitled to use for the development of the Defendants’ Y-Test. There is no doubt that Diagcor had carried out its research about the development of the Plaintiff’s Y-Test, and all the information about the Plaintiff’s Markers and their associated primer and probe sequences was trade secret and was confidential in nature.

66.According to Joseph, Y-Test is a matter about “life and death”. He firmly believes that the Defendants could not have finished the clinical validation of the Defendants’ Y-Test within such a short period of time. However, as there is no gold or universal standard for clinical validation of Y-test, I do not propose to deal with Joseph’s evidence about the proper time needed for clinical validation of the Defendants’ Y-Test.

67.Indeed, for the reasons as further elaborated in the latter part of this Judgment, I do not believe that I need to resolve most of the other factual disputes between the evidence of Joseph and that of the Defendants’ witnesses. First, the result of this case does not turn on who was right and who was wrong which led to the breakdown of the relationship between the relevant parties. Second, part of Joseph’s evidence is only suspicion on his part. Instead of relying on Joseph’s evidence, the court should look at the objective evidence in the present case to decide whether, as a matter of inference, that the Defendants had used the Confidential Information in developing the Defendants’ Y-Test.

68.Chu and Rebecca were the respective developers of Gen 1 and Gen 2 of the Plaintiff’s Y-Test, and they provided the court with their accounts as to how these respective tests were developed. I accept Chu and Rebecca to be honest and reliable witnesses. They provided straightforward answers to the court, and they made no attempt to evade any questions put to them during cross-examination.

69.Mr Ng attacks the credibility of Chu’s evidence by saying that: (i) she tried to implicate Billy in the decision making process in respect of the number of markers used for the Plaintiff’s Y-Test; and (ii) she lied about Joseph’s knowledge of the number of markers used in the Plaintiff’s Y-Test. He also attacks Rebecca’s evidence by saying that: (i) she wrongly claimed that the Gen 2 test was a modification of Gen 1 test; and (ii) she lied about certain aspect of the clinical validation of the Gen 2 test.

70.I do not accept these submissions. Chu and Rebecca are technical personnel who only helped Diagcor to develop both generations of the Y-Test. As compared with the other witnesses, they do not have any direct interest in the outcome of the proceedings. I do not accept that they would have fabricated evidence just for the purpose of supporting Diagcor’s case. As they were involved in the development of the tests many years ago, I do not accept that any mistakes they made in their evidence were deliberate, and I do not find that the observations made by Mr Ng above would affect the credibility of their evidence in any way.

C.II  The factual witnesses in support of the Defendants’ case

71.Billy, Rhys, Maggie, Peggy, Terry and Alan testified in support of the Defendants’ case.

72.Billy provided the court with the details of his relationships with Diagcor, Joseph and the other Defendants. He gave his own account about the events leading to the dispute in the present Action. By reason of his managerial position in Diagcor, he had access to the Confidential Information. Yet, he denied that he had obtained the Confidential Information without Diagcor’s consent or used the Confidential Information to develop the Defendants’ Y-Test.

73.As mentioned above, I do not find it necessary to decide who was responsible for the breakdown of the relationship between the parties. However, I do have doubt about the credibility of Billy’s evidence, in particular as to how he joined the Corporate Defendants and his role in the early operation of the Corporate Defendants and the development of the Defendants’ Y-Test.

74.Indeed, Billy had tried very hard to distance himself from the setting up of the new business operated by the Corporate Defendants (“the New Business”). However, since Terry and Alan had very little experience in the highly technical bioscience industry, Billy should have played a key role in the New Business set up by them. Billy claimed that he only decided to join the New Business in August 2012, yet the objective evidence shows that Terry and Alan took steps to start the New Business as early as July 2012. Taking into account their limited experience in bioscience industry, I do not accept that they would have started the New Business without some sort of commitment by Billy, and the only reason as to why Billy tried to defer his time of joining the New Business is that he tried to distance himself from the development of the Defendants’ Y-Test.

75.Billy even claimed that when he joined the New Business, he was not interested in running the Y-test business, and instead he wanted to explore the possibility of starting other life science businesses. However, since Billy had vast experience in a business with a success built heavily on the Y-test (ie. the business of Diagcor) and the first business operated by the New Business was exactly the provision of Y-test, I do not accept that Billy had been telling the truth in this regard. Further, the fact that he did not mention this important “fact” in his past numerous affirmations also undermine the credibility of his “explanation”.

76.Further, I accept the submission of Mr Lo, counsel for Diagcor, that Billy was evasive in providing discovery of the validation data for the Defendants’ Y-Test. Diagcor’s request for the Defendants’ validation data[2] is a simple one, and yet the Defendants tried to delay the provision of the relevant data. In §34 of Billy’s 3rd Affirmation, he even seemed to suggest that the Defendants had not conducted any validation for the Defendants’ Y-Test at all. Mr Lo submits that the reason why Billy made an initial attempt to hide the Defendants’ validation data was because such data would expose the fact that the set of primers and probes allegedly used for the Defendants’ Y-Test was nothing but a smokescreen. If the data really supported the Defendants’ case of the use of an independently developed set of primers and probes used in the Defendants’ Y-Test, Billy had no reason to hide them. There is certainly weight in such submission.

77.For these reasons, I do not accept Billy to be a reliable witness. In any event, I would point out that, for the purpose of determining the merits of both the Confidential Information Claim and the Negligence Claim, I do not need to resolve the factual disputes between Billy’s evidence and that of Joseph, in particular about the background leading to the breakdown of the relationship between the relevant parties. Nevertheless, one thing is clear from the documentary evidence. The evidence shows that when Joseph and Billy left the employment of MGC, they were cautious about any possible legal claim that might be brought by MGC complaining about the use of MGC’s confidential information.

78.Rhys was the person who allegedly developed the Defendants’ Y-Test independently without using the Confidential Information. As I will further elaborate in the latter part of this Judgment, Rhys’ evidence is most important in determining the merits of the Confidential Information Claim. I will address the credibility of his evidence when I later deal with the merits of such claim.

79.Maggie was the Associate Laboratory Manager of Diagcor before joining the New Business. Her evidence mainly relates to the Negligence Claim. I will deal with the credibility of her evidence when I address the merits of the Negligence Claim.

80.Peggy was the Corporate Manager of Diagcor before joining the New Business. Holding such position, she was responsible for Diagcor’s administrative works. Peggy admitted that she had full access right to the R&D documents stored in Diagcor’s server, but she denied that she had obtained the Confidential Information and passed it to any of the Defendants to develop the Defendants’ Y-Test. She also denied that Billy was her close associate.

81.In my judgment, Peggy’s evidence is of limited assistance in the present case. Whether she was a close associate of Billy is neither here or there. In any event, since she was not a person with a science or computer background, even if the Defendants had used the Confidential Information to develop the Defendants’ Y-Test, it might not be Peggy who had obtained the Confidential Information from Diagcor’s database. At most, she might have had knowledge about the improper conduct of the other Defendants.

82.Terry was very much a sales person with no scientific training or experience in bioscience industry. Again, Terry claimed that he had started the New Business in early July without having secured Billy’s participation. However, without any relevant experience in such a highly technical industry, I do not believe that Terry would have started the preparation of the New Business unless he had secured some sort of commitment by Billy. Further, he was evasive when he was asked about how he obtained the contact details of Billy. In my judgment, Terry had not told the court the whole truth about Billy’s role in the New Business, and he only made an unsuccessful attempt to distance Billy’s role in the development of the Defendants’ Y-Test which was launch product of the New Business.

83.The speed as to how fast Terry and Alan came to an agreement to start the New Business also undermines the credibility of Terry’s evidence. Indeed, there is inconsistency in Terry’s evidence as to the exact time when he made an agreement with Alan to start the New Business. In any event, there is no serious dispute that they made the agreement after only a few discussions. With no experience in such a highly technical industry, I doubt very much whether they could have reached an agreement so soon without first securing the participation of Billy. For these reasons, I also do not accept that Terry is a reliable witness.

84.Alan also testified at the trial. For the same reasons as mentioned above, I have doubt in his evidence about the setting up of the New Business. In any event, Alan was only a passive investor in the New Business and so his evidence is of limited assistance in this case.

C.III  The expert witnesses of the parties

85.The Plaintiff’s expert witness is Professor So Chi Wai Eric (“Professor So”) and the Defendants’ expert witness is Professor Cheung Ching Lung (“Professor Cheung”).

86.Both experts have impressive qualification and experience in the relevant area of bioscience. No one is seriously disputing the qualification of these professors as experts.

87.Both expert witnesses appeared before me in a technical briefing on 9 and 10 April 2024 (about 1.5 month before the substantive trial on liability) to provide the court with the technical facts and concepts that the court need to understand in tackling the issues in the present case. The court treated the technical briefing as part of the trial. Counsel were not allowed to ask questions in the technical briefing and only the court could ask question in order to understand the basic technical facts and concepts concerned. Counsel could ask questions from the experts in the substantive trial.

88.I find that the technical briefing was very useful for the court to understand the technical issues in this case. It would actually shorten the time of the substantive trial. In fact, I find that there is not much divergence in the views of the two experts. In particular, Professor Cheung, whilst maintaining the view that Rhys could have developed the Y-Test independently, accepts that it is ultimately a matter for the court to decide whether to accept the evidence of Rhys after testing his credibility at the trial.

89.Both camps have made lengthy submissions to attack the credibility of the expert evidence of the other side. In particular, Mr Ng submits that; (i) Professor So was wrong to suggest that there was a gold standard for clinical validation of a Y-Test; (ii) he had mislead the court about the chances of overlapping of markers for both sides; (iii) he had adopted double standards in comparing the clinical validations of both sides; and (iv) he was biased when he made the assertion that the Defendants could not have developed the Defendants’ Y-Test by themselves.

90.Despite these challenges, I do not find that both experts had made any attempt to distort their opinions with a view to support the case of the respective parties. Professor So’s evidence only represents the “old-school” approach which may be more cautious on clinical validation and the use of research parameters. On the other hand, as there is no universal standard on clinical validation of Y-Test, Professor Cheung took the view that the Defendants could have completed the development of the Defendants’ Y-Test within such a tight timeframe. Yet, what is most important is that Professor Cheung also found that it was quite a coincidence that Rhys had found the MK15 Marker from a source which they cannot locate now[3], and ultimately the question remains whether the court would accept Rhys’ evidence as the truth.

91.Furthermore, as I will further elaborate in the latter part of this Judgement, I am not prepared to draw any adverse inference against the Defendants by reason of the short time taken for the clinical validation of the Defendants’ Y-Test. In such case, the difference between the two expert opinions on such matter is not a material consideration in the present case.

92.With these observations on the evidence at the trial, I then deal with the merits of the Confidential Information Claim and the Negligence Claim. I first start with the Confidential Information Claim.

D.  THE CONFIDENTIAL INFORMATION CLAIM

93.There is no serious dispute about the legal principles governing a claim for breach of confidence based on contract or equity.

94.Insofar as the Confidential Information Claim is concerned, there is no dispute about the following matters:

(i)  The Plaintiff’s Markers used by Diagcor in the conduct of its Y-tests and the other information as mentioned in §30 above are confidential information and trade secret of Diagcor (i.e. the Confidential Information”), and the Defendants were not entitled to use such information in developing the Defendants’ Y-Test.

(ii)  Billy, Rhys and Peggy, by reason of their previous employment with Diagcor, did have access to the Confidential Information.

95.Despite such access, the Defendants deny that they had used such information in developing the Defendants’ Y-Test. According to the Defendants, Rhys was the main person responsible for developing the Defendants’ Y-Test. Hence, his evidence is most important. If the court accepts his evidence, the court has to find that the Defendants did independently develop the Defendants’ Y-Test without using the Confidential Information. On the other hand, if the court rejects his evidence, the court can make an inference that he or the Defendants did use the Confidential Information in developing the Defendants’ Y-Test.

D.I  The evidence of Rhys

96.Rhys graduated with a bachelor’s degree in Biology in 2003. As compared with Diagcor’s researchers and Billy, Rhys had lower qualification and less experience in the bioscience field. He was not involved in the research or development of the Plaintiff’s Y-Test.

97.Rhys’ first job was in MGC, where he worked with Joseph, Billy, Maggie and Peggy. In 2006, all of them joined Diagcor. As Diagcor’s IT Officer, Rhys admitted that he all along had the access right to the Plaintiff’s whole computer server where the Confidential Information regarding the Plaintiff’s Y-Test was stored. He was first approached by Terry to join the New Business on 17 July 2012.

98.At the trial, Rhys gave the court a detailed account as to how he developed the Defendants’ Y-Test and picked the Defendants’ Markers for the conduct of the Defendants’ Y-Test. His work started in late July 2012 after he accepted the invitation by Terry to join the New Business. He browsed the established websites in the internet and obtained the relevant research articles. He then looked for the immediately usable markers which the primers and probes sequence had been published in the relevant articles.

99.To generate the markers for the Defendants’ Y-Test, the relevant articles were used as the starting point for reference the Y-specific region. Rhys then explained as to how he worked out the Defendants’ Markers by referring to the published Y-specific region. He also explained how he used certain software programme such as “PrimerExpress” to sort out the most suitable primers and probes for him. The primer and probe set would then be selected and he would place the order with the supplier. He repeated the process for all the markers needed.

100.According to Rhys, it took him about a week’s time or so to finish the design and selection process. He then placed orders with suppliers of primers and probes in early August 2012. Since a lot of time would be wasted by waiting for the delivery of the primers and probes, he adopted a “shotgun” approach and ordered all versions of the primers and probes sets.

101.15 markers were used in the Y-Test reports provided by a competitive laboratory service provider Zentrogene. As some of the markers used in the development stage might fail to generate the expected result, he targeted to use 30 markers. Eventually, he picked 27 markers for development purpose which is a number close to 30.

102.All the ordered primers and probes arrived in or about mid to late August 2012. One Dr Vincy Wong (“Vincy”) and Constance then helped Rhys in the validation process to check amongst all the 27 Y-markers to ascertain which markers performed better. He also told the court about a “hiccup” during the validation process. Eventually, 17 markers were shortlisted for their better performance. To speed up the validation process, the development team used samples of anonymous pregnant mothers’ blood obtained from some business connections to conduct the tests, and telephoned the sources to double-confirm results on the sex of the fetus they detected to verify accuracy of the Defendants’ Y-Test.

103.After the validation process was over, the team finally decided to use 15 best performance markers for the Defendants’ Y-Test.  There was no need to have too many markers for the actual test as more markers meant more costs and did not add much value to the test. The number of 15 was by then already a benchmark in the market.

104.The New Business obtained the first order for the Y-Test on 10 September 2012 with the report issued on 12 September 2012.

105.According to Rhys, there are many reasons to explain why it took much less time to develop the Defendants’ Y-Test than the time used by Diagcor to develop its test which was around 6 months from October 2006 to March 2007.  A lot of changes have taken place over those years. Factors such as maturity of the maternal blood test in lieu of traditional methods of Chorionic villus sampling (CVS) or amniocentesis, acceptability of such blood test in the market, convenience of obtaining samples for test-run, availability and advancement of ready-to-use reagents to be used in the test and upgrade of software technology used in the test can make much differences in affecting test development time.

106.Further, there is no universal standard for the validation process. The extent of validating accuracy of one’s test is a matter of commercial judgment, and different service providers adopted different standards.

107.According to Professor Cheung, Rhys could have developed the Defendants’ Y-Test within such a tight timeframe in the manner described without using the Confidential Information.

108.Rhys had also compared the markers used respectively in the Plaintiff’s Y-Test and the Defendants’ Y-Test. The result of comparison shows that there are only two common Y-markers used in both sides’ test and all these common markers (i.e. MK03 & MK27 of the Defendants’ Y-Test) are markers found in the public domain. As to other 13 Y-markers used in the Defendants’ Y-Test, there are 4 pairs of markers having their location regions partially overlapping with the Plaintiff’s Markers but are not on the exact locations. Although there exists overlapping of some regions in these 4 pairs of markers, it is clear that the respective primers (forward and reverse) and probes used by the Plaintiff and the Defendants are totally different from each other. The size of base pairs of the markers used in both sides’ tests is also totally different. Apart from the aforesaid 4 pairs, the remaining 9 pairs of markers are located in totally different regions with no overlapping at all.

D.II  Diagcor’s attack on the credibility of Rhys’ evidence

109.Diagcor attacks the credibility of Rhys’ evidence on the following grounds:

(i)  Rhys’ evidence that he was the person responsible for developing the Defendants’ Y-Test is inconsistent with the Defendants’ pleaded case.

(ii)  The court should draw adverse inference against the Defendants’ case as they have failed to call Vincy or other related possible witnesses to testify at the trial.

(iii)  Rhys’ evidence about the alleged development process is flawed as: (a) Rhys’ alleged literature search process was factually impossible; (b) there was no contemporaneous record of Rhys’ alleged design process; and (c) Rhys’ evidence on validation of the Defendants’ Y-Test is filled with uncertainties.

(iv)  The presence of the Defendants’ MK15 and MK16 Markers in the design process confirms that the Defendants were copying and using the Plaintiff’s Markers in developing the Defendants’ Y-Test.

(v)  The Defendants’ alleged validation of the alleged MK Markers was so deficient that the Defendants could not have used them in designing the Defendants’ Y-Test.

110.I must say that Rhys first appeared to me to be a straightforward witness. He answered most of the questions put to him without any hint of evasiveness. Yet, I have to conclude that he was not telling the truth to the court, and ultimately I have to reject his evidence as unreliable. In my judgment, Grounds (i) and (iv) above are most fatal to the Defendants’ case. In particular for Ground (iv), I do not accept that Rhys looked up MK15 by himself. The fact that MK15 was used in the development stage of the Defendants’ Y-Test could not have been a matter of mere coincidence, and the court can rely on the presence of the Plaintiff’s footprint to infer that the Defendants did use the Confidential Information in developing the Defendants’ Y-Test. Each of the other grounds relied on by Diagcor may not by itself be sufficient to destroy the credibility of Rhys’ evidence, but all these grounds, when considered as a whole, certainly raise doubt about the reliability of Rhys’ evidence. I will now explain why I reach such conclusion by addressing each of these grounds in turn.

D.II.1  Inconsistency with the Defendants’ own pleaded case

111.Upon the request made by Diagcor for further and better particulars of the plea in §32 of the Defendants’ initial Defence that they developed the Defendants’ Y-Test independently, the Defendants answered on 16 May 2013 that: (i) the development of the Defendants’ Y-Test commenced in around the end of July 2012; (ii) Vincy was person involved and responsible for the test development at the material time; and (iii) Vincy was the person responsible for designing the primers for the Y-markers used.

112.The said §32 was deleted in the subsequent amended pleading, and yet the Defendants maintained that the Defendants’ Y-Test was independently developed without reference to the Plaintiff’s Markers. More importantly, the said answers provided by the Defendants (“the Answers”) have not been retracted or amended, and the Defendants have never pleaded that Rhys was the developer of the Defendants’ Y-Test instead of Vincy. In other words, the Defendants’ pleaded case has all along been that it was Vincy (and Vincy alone) who was involved in the development of the Defendants’ Y-Test starting in late July 2012 and designed the primers for the Y-markers.

113.The Defendants’ witnesses tried to offer explanations for such inconsistency. Billy and Rhys put the blame on the miscommunication between the Defendants and their then lawyers. However, the request was straightforward, and it is difficult to understand how any alleged miscommunication would have resulted in such a huge discrepancy in the Defendants’ case. Furthermore, after the change of solicitors from Wong & Wong to Fairbairn, Billy continued to say in his 1st Affirmation that Vincy actually started her work on developing the Defendants’ Y-Test by the end of July 2012. He even referred to the Answers without suggesting that they were wrong or incomplete in any way. Neither did Billy dispose in that affirmation that Rhys was in fact the developer of the Defendants’ Y-Test. When being confronted on these matters, both Billy and Rhys could not provide any satisfactory explanation.

114.In a desperate attempt to provide an explanation, Peggy and Terry claimed that the Defendants’ former solicitors did not show the original Defence and the Answers to the Defendants. However, I find it hard to accept that the Defendants’ former solicitors would have committed such serious misconduct on two occasions when the Defendants filed the original Defence and the Answers. It is also difficult to explain why Billy continued to provide the same line of defence after the change of their solicitors. In any event, Peggy never said that the contents in the original Defence or the Answers were wrong or incomplete.

115.Terry gave a further explanation at the trial. According to him, his friend one Mr Albert Tsang referred Vincy to him in June 2012. In late June, he had a meeting with Vincy, during which Vincy agreed to help the New Business to develop the Y-test and she would be the sole person taking a leading role. About two weeks later in July, Vincy said she could not manage the work and declined the offer. Terry then asked her to take a rest first. Under such circumstances, the statement in the Answers stating Vincy to be the developer of the Defendants’ Y-Test was technically correct. When it was put to him why the Answers did not mention Rhys, he said it was just omission on the part of the Defendants.

116.I reject such explanation. Apart from the fact that his account about his dealing with Vincy, which should be an important fact, has never appeared in his witness statements, his stance has never been consistent. When he tried to put the blame on the Defendants’ then solicitors, he seemed to suggest that the Answers were wrong in stating that Vincy was the developer of the Defendants’ Y-Test. In providing his account about his dealing with Vincy in June 2012, he then seemed to say that the Answers were correct. Such inconsistent stance certainly casts doubt on the credibility of his evidence.

117.For these reasons, there is weight in Diagcor’s attack under Ground (i). Coupled with the other factors mentioned below, I reject Rhys’ evidence about the independent development of the Defendants’ Y-Test.

D.II.2  Drawing of adverse inferences by reason of absence of possible witnesses

118.Diagcor also submits that the Defendants should have called Vincy, Constance, and two other persons allegedly involved in the clinical validation of the Defendants’ Y-Test, namely Trista and Justin, to testify at the trial. Mr Lo asks the court to draw adverse inference against the Defendants’ case for the absence of these possible witnesses.

119.Since Rhys has already given evidence on the clinical validation of the Defendants’ Y-Test, I do not accept that the court should draw any adverse inference against the Defendants for the absence of Constance, Trista or Justin at the trial. Indeed, Constance was in the list of witnesses, and Trista and Justin have made witness statements filed with the court (mainly giving evidence on the wrongful solicitation claim). As Diagcor did not raise any issue when the Defendants decided not to call them to testify, their absence should not be a factor in considering the merits of the case.

120.The absence of Vincy is more significant, in particular when the Defendants had earlier stated in the Answers that Vincy was the person involved and responsible for the test development at the material time and she was responsible for designing the primers for the Y-markers used. By making such statement, Vincy should have played a significant role in the clinical validation of the Defendants’ Y-Test if not in the designing or development stage of such test.

121.When asked about such issue, Billy, Peggy and Terry claimed that they had tried to contact Vincy for her to testify at the trial. Apart from the lack of documentary evidence to support their allegation (WhatApps messages in the case of Billy), such allegation, if true, appears to me to be half-hearted attempts made by these witnesses to justify the absence of Vincy at the trial. Further, Vincy was referred to Terry by a common friend, and more evidence should therefore be forthcoming to explain why Vincy could not be contacted to testify at the trial. It is also difficult to explain why Rhys, being the alleged project leader working with Vincy and Constance in the validation process, did not take any steps to contact Vincy. Finally, since I do not accept Billy and Terry, and to a certain extent Peggy, as reliable witnesses, I do not accept their evidence in this regard.

122.In my judgment, the absence of Vincy at the trial is not a significant factor to be considered against the Defendants’ case. But coupled with the other factors, I reject Rhys’ evidence about the independent development of the Defendants’ Y-Test.

D.II.3   The complaint that Rhys’ evidence about the alleged development process is flawed

123.The first complaint by Diagcor in this regard is that Rhys could not have obtained access to the two papers with Mannis van Oven as the first authors (collectively “the van Oven Papers”), namely “A multiplex SNP assay for the dissection of human Y-chromosome haplogroup O representing the major paternal lineage in East and Southeast Asia” published in Journal of Human Genetics (2012) and “An efficient multiplex genotyping approach for detecting the major worldwide human Y-chromosome haplogroups” published in International Journal of Legal Medicine. According to Rhys, he obtained these papers, and indeed all the papers for his research, by way of open access. But according to Professor So, the “Journal of Human Genetics” – in which the first paper obtained by Rhys was published in November 2011 – had not begun to provide open access in 2012 (i.e., when the Defendants’ Y-Test was developed), such that the public had to pay a fee to obtain access to that paper. Hence, Rhys could not have obtained such paper by way of open access when the Defendants’ Y-Test was allegedly developed.

124.Since the complaint had not been put to Rhys during cross-examination, it is not appropriate for the court to draw any adverse inference against the Defendants’ case by reason of such complaint. Further, there might be a lot of different reasons to explain about the payment mechanism of certain journals many years ago, and so it would not be safe for the court to take such matter into account in drawing any adverse inference against the Defendants’ case.

125.The second complaint is about the lack of contemporaneous record of Rhys’ alleged design process. The various screencaps produced by Rhys were subsequently generated to illustrate the methods as to how he designed the Defendants’ Y-Test. However, if such test was indeed designed by him, there should have been some contemporaneous records showing that: (i) it was Rhys who designed and selected the Defendants’ Markers; and (ii) how exactly those markers were designed and selected by Rhys himself. In particular, Rhys failed to produce an Excel file which he claimed was produced during the design process.

126.There is some weight in such submission. Taking into account the previous experience of leaving MGC, Billy, whom I believe should have played some role in the development of the Defendants’ Y-Test, should have known full well that Diagcor would make some serious complaint against him and the New Business after the launch of the Defendants’ Y-Test. Hence, keeping of documents showing the independent creation of the Defendants’ Y-Test should have been a top priority. Even Rhys should have known about this. The absence of contemporaneous supporting documents certainly undermines the credibility of the Defendants’ case.

D.II.4  The presence of some of the Plaintiff’s Markers in the alleged design process of the Defendants’ Y-Test

127.I find that the presence of the Plaintiff’s footprint in the markers used by Rhys in the alleged design process of the Defendants’ Y-Test to be a strong, if not decisive, factor for rejecting the Defendants’ case about the independent development of their Y-Test.

128.At §34.24 of Rhys’ second witness statement, he said that 5 markers were “directly adopted from reference articles”, including MK15 and MK17 for which two source references were allegedly “lost”. According to Rhys, as he was doing literature search at home, due to computer breakdown, he could no longer retrieve the two “lost” source references. He even claimed that he could not find them using the keywords to search because the reference journal might have disappeared on the internet.

129.For MK15, Professor Cheung “found that both primers should be generated from the literature” first authored by Valerio Onofri, “in which the reserve primer was exactly the same, while the forward primer was almost the same” (“ the Onofri Paper”).

130.The Onofri Paper was as one of the papers used by Rebecca for developing the Plaintiff’s Y-Test. During her testimony, she explained that:

(i)  She had reviewed the Onofri Paper and compared the allelic frequency and amplicon size of the markers listed therein, and used “M9/rs3900” marker as the starting point. She exercised her skills to design the Plaintiff’s FM01 Marker on Primer Express.

(ii)  For the reverse primer, Rebecca directly adopted it for FM01. But for the forward primer, she cut short the one from the Onofri Paper by cutting out the “TA” end, as she took the view that it would save costs for 2 base pairs while still fulfilling her PCR requirement.

(iii)  As for the probe, Rebecca designed the probe afresh as none was suggested in the Onofri Paper. Rebecca tried various segments, checked parameters (e.g., annealing temperature at 70°C), and after trial and error, eventually designed the probe for FM01.

131.Diagcor has submitted Exhibit P-3 to compare: (i) the Plaintiff’s FM01; (ii) the Defendants’ MK15; and (iii) the “M9/rs3900” from the Onofri Paper. As one can see from the following table, MK15 is exactly identical to FM01 in all aspects including forward primer, reverse primer and probe sequences. When compared with “M9/rs3900”, both FM01 and MK15 cut the “TA” end in the forward primer sequence, and added an identical probe.

  Forward Primer Reverse Primer Probe
FM01 AGAACTGCAAAGAAACGGCC TGCATAATGAAGTAAGCGCTACCT GACATGTTCAAACGTTCA
MK15
(not in use)
AGAACTGCAAAGAAACGGCC TGCATAATGAAGTAAGCGCTACCT GACATGTTCAAACGTTCA
rs3900 (M9) AGAACTGCAAAGAAACGGCCTA TGCATAATGAAGTAAGCGCTACCT N/A

132.The fact that MK15 followed FM01 in cutting the last two “TA” in the forward primer is strong indicium of copying. Despite such clear evidence, Rhys denied that MK15 was copied from FM01. Rhys even challenged that it was not a valid reason for Rebecca to cut the “TA” end just to save costs. However, whether Rebecca’s reason is valid or not is beside the point. The fact remains that MK15 is identical to FM01, and even this struck Professor Cheung as odd such that he could not rule out the possibility of copying.

133.As stated in Vestergaard Frandsen A/S v Bestnet Europe Ltd[4],[t]he use by an alleged copyist of odd or unusual detail found in the original is often a tell-tale of copying”.

134.Probably realising this, Rhys disowned the Onofri Paper as the source reference, claiming that there was another paper with the exact same primers and probe of MK15, which Rhys claimed he could not find. He added that some open access journals on PubMed might have been deleted.

135.However, as Professor So explained, references on PubMed would not disappear without a trace. Although “out-of-scope” citations (eg. news) may be deleted, research papers do not fall within such categories. Even for retracted papers, PubMed would keep their records with a separate retraction notice.

136.To counter Professor So’s observation, the Defendants submitted two articles[5] to argue that open access journals may disappear from the Internet. However, even the Defendants’ own expert witness Professor Cheung conceded that these two articles are totally irrelevant to the issue of records disappearance on PubMed, which was the only database used to carry out literature search according to Rhys.

137.The Defendants then argued that some journals might be delisted and removed from PubMed due to their substandard quality. As an example, the Defendants pointed to an article reporting that PubMed delisted 14 journals.[6] Again, Professor Cheung conceded that he could not tell whether Rhys’s “lost” paper for MK15 would have come from these 14 delisted journals, and he was only suggesting a theoretical possibility which he admitted is unlikely.

138.Despite the searches done by both experts, neither of them can find this “lost” paper for MK15. As Professor So explained, he had conducted a search on Google using the primers and probe sequences of MK15, and he only found the Onofri Paper upon search of the reverse primer sequence, while the forward primer sequence and the probe sequence gave him no results.

139.Rhys claimed to have “marked down” the source references for each of the Defendants’ Markers in an Excel file during his alleged design process. As observed by Mr Lo, that being the case, Rhys should have had no difficulty in supplying at least the title of this allegedly “lost” paper for MK15 if it existed.

140.Indeed, I find it extremely odd that Rhys did not keep proper documentation or contemporaneous record of his research process. Rhys, being an educated person, should have known that Diagcor would very likely question the genuineness of the Defendants’ Y-Test under the circumstances that: (i) Rhys and some other persons were leaving Diagcor and joined the New Business at more or less the same time; and (ii) the New Business launched a new Y-test to compete with the Plaintiff’s Y-Test, the conduct of which was the main and most profitable business of Diagcor by that time, within such a short period of time (i.e. about 2 months from early July to 12 September 2012). One does not need to be a lawyer to understand the risk involved. In such case, Rhys should have been particularly alert in keeping all the research materials to support the genuineness of the Defendants’ Y-Test. Furthermore, I do not accept that Billy had not taken any part in the early development of the New Business. As he was no stranger in similar circumstances (ie. the experience of Joseph and him leaving MGC), he should have reminded other participants of the New Business to keep proper documentation of the research process if their account about the development of their Y-Test were genuine.

141.To counter such observation, Mr Ng submits that Diagcor likewise has not kept full documentation of all their research effort. Apart from the fact that whether such challenge is factually correct, the Plaintiff’s situation was very different from that facing the Defendants. Both generations of the Plaintiff’s Y-Test were developed many years ago. By that time, the risk of other people challenging the genuineness of its test was minimal if not non-exist.  On the other hand, it was very likely that Diagcor would go after them after the launch of the Defendants’ Y-Test. The non-keeping of full or proper documentation under such circumstances was most unusual.

142.The use of the forward primer in MK15 (with the missing TA) is strong indicium of copying. This could not have been coincidental. If I were to accept Rhys’ evidence, it would mean that, for some peculiar reasons, Rhys did not keep proper documentation of his research materials. It would also mean that, under such circumstances, the reference material that he used in designing MK (with the forward primer missing TA) is, as a matter of coincidence, also missing on the internet.

143.Rhys at one stage mentioned that his computer broke down and so he lost the reference material for MK15 including its associated primers and probe sequences. If that were indeed the case, it would mean all these things happened at the same time: (i) Rhys’ computer happened to break down at this crucial moment beyond repair losing the reference material for MK15; (ii) such reference material, for some peculiar reasons, also disappeared on the internet; and (iii) this lost reference material contained a marker with the same forward primer with the missing “TA” in the end. The coincidence does not end here. For some peculiar reasons, there was serious miscommunication between the Defendants and their then lawyers, such that the Answers stated wrongly that Vincy instead of Rhys was the designer for the Defendants’ Y-Test, and the Defendants’ then solicitors committed serious errors by not showing the original Defence and the Answers to the Defendants before the filing of these two important court documents. If I were to accept the defence case, it would mean that all these things, as a matter of coincidence, happened at the same time. In my judgment, this was most unlikely to be the truth.

144.In support of the Defendants’ argument, Mr Ng submits that, had the Defendants (who are sophisticated persons) conspired together to steal and use the Plaintiff’s Markers, it would be very difficult to understand why they had not removed all the Plaintiff’s footprint in disclosing their markers, in particular when they did not use MK15 in the actual test itself. Indeed, MK15 had gone through entire functional validation process, including ordering of its primers and probes sequences, conducting 2 test runs and testing on known maternal blood sample. The entire process lasted from 1 September 2012 to until discovery in September 2015. If Diagcor’s theory is that the Defendants were developing a smokescreen, the question then goes to why would all the Defendants place this stolen FM01 (which is of the same sequence as MK15) into the smokescreen? Another question is why the Defendants had to validate this MK15? Also another question is why could any of the Defendants not discover over a long period of time that they had included MK15 into the smokescreen? According to Mr Ng, this defies common sense. Even if the Plaintiff can prove that the Defendants had stolen FM01 (which is of the same sequence as MK15), it still cannot prove that the Defendants had stolen the rest of their markers (FM02-15).  Further, if Diagcor’s theory stands i.e. the Defendants carelessly left the stolen copy of FM01 (i.e MK15) in the smokescreen set, then why did the Defendants have to create a MK17 also with lost reference and further open themselves to Diagcor’s attack? It would be much simpler and with less effort for the Defendants to create a MK17 with reference.

145.Despite the able submission of Mr Ng, I cannot accept his argument. When some persons (in particular when they were formerly working for the claimant) try to steal and use the confidential information of the claimant to develop a new test and launch such test to compete with the claimant within a short period of time, those persons would normally try to make some effort to conceal their unlawful act. In designing a concealment plan, mistakes can be made, in particular with designing a technical test like the present one. Obviously, one should be careful trying to avoid the concealment plan being exposed, but simple mistakes may still occur. After all, the concealment plan involves something which did not actually happen. In trying to put up a false front, one may not have thought about all the aspects of the plan, and as a result the concealment plan can be exposed after a careful examination in a trial.

146.I find that this was the case here. I do not need to repeat the observations I made earlier as to why I find it extremely odd that Rhys did use MK15 in developing the Defendants’ Y-Test, and why he had not kept proper documentation about the development process in the view of the likely challenge by Diagcor about the genuineness of the Defendants’ Y-Test. Proving stealing and using of a claimant’s confidential information and trade secret is not always easy, and yet I find that Diagcor has discharged the burden of proving the same against the Defendants in the present case.

147.Mr Ng submits that it is not uncommon for the designer of a Y-test to lose the reference materials for the markers. According to the joint expert report, both experts cannot locate the reference materials for 3 markers for the development of the Plaintiff’s Gen 2 Y-Test, namely FM06, FM07 and FM13. However, there is no dispute that Rebecca was a researcher with much higher qualification and experience. She gave a detailed account as to how she developed the Plaintiff’s Gen 2 Y-Test, and there is no serious challenge about the originality of the test she developed. On the other hand, Rhys was a person with much lower qualification and experience, and so he had to rely on more readily available materials on the internet to develop the Defendants’ Y-Test as described by him in his evidence. Facing a likely challenge to the genuineness of the Defendants’ Y-Test, he claimed that he lost the reference material for MK15. I have already explained above as to why all the circumstances of this case do not support Rhys’ account in this regard, and so I do not find that Mr Ng’s argument would discredit the claim of Diagcor in any way.

148.Mr Ng further submits that the New Business had paid about $160,000 to purchase all of the primers and probes in respect of the Defendants’ Markers. He argues that if the Defendants had used or copied the Plaintiff’s Markers in developing the Defendants’ Y-Test, there was no need for the New Business to have spent so much money in purchasing the primers and probes.

149.I do not accept that such argument can advance the defence case any further. There might a lot of reasons as to why the New Business agreed to pay such sum of money. In any event, the Defendants had to make some effort to support the “genuineness” of the Defendants’ Y-Test. As compared with the profit expected to be generated from the Y-test, such kind of expenses might be justified.

150.For these reasons, I have to reject Rhys’ evidence about the alleged independent creation of the Defendants’ Y-Test. Based on all the evidence in the present case, I find that the Defendants had, on the balance of probabilities, used the Plaintiff’s Confidential Information to develop the Defendants’ Y-Test so that such test could be launched within a short period of time.

151.Mr Lo goes further and raises doubt as to why Rhys subsequently decided to choose MK16 instead of MK15 for the Defendant’s Y-Test. This, according to Mr Lo, makes Rhys’ evidence incoherent from a scientific point of view. Mr Lo submits that, even on the assumption that the Defendants did use the alleged MK Markers in the Defendants’ Y-Test, the likely reason for the Defendants’ decision to eliminate MK15 while keeping MK16 (that overlaps substantially with FM01/MK15) is that they well knew FM01/MK15 would work in a Y-test, and in an attempt to avoid being accused or held liable for copying, they chose not to use MK15 but to use MK16 instead. In other words, the Defendants used FM01 as a springboard to “develop” MK16.

152.In support of his submission that MK15 was a better-performed marker, he relies on the test result dated 3 September 2012 shown in a document with the title “Class 2i – sensitivity data”. However, since the result of the test done earlier on 1 September 2012 might give a different indication as to whether MK15 or MK 16 was a better-performed marker, it is not appropriate for the court to draw any adverse inference against the defence case by reason of Mr Lo’s further submissions. After all, it involved a judgment by the designer of the Y-test to decide which was a better marker ultimately to be used in the test.

D.II.5  The alleged deficiency about the validation of the Defendants’ Y-Test

153.As a further attack against the alleged independent creation of the Defendants’ Y-Test, Diagcor claims that the Defendants’ purported validation of their test is far from being genuine. Mr Lo has advanced four grounds in support of such submission:

(i)  The Defendants’ alleged validation lacked sensitivity or limit of detection (“LOD”) testing.

(ii)  The Defendants’ alleged setting of “Ct cut-off” value was unsafe and illogical.

(iii)  The Defendants’ alleged validation lacked met-curve runs to check the primer specificity.

(iv)  The Defendants’ alleged clinical validation was fundamentally flawed and suspicious.

154.According to the testimony of Joseph and Professor So, they do not believe that the Defendants could have completed the validation of the Defendants’ Y-Test within such a short period of time. In his final submissions, Mr Lo has not relied on this as a separate ground to challenge the genuineness of the Defendants’ validation. Such complaint may have merged with the other grounds of complaint, but given that there was no universal standard for validation of Y-test, I am not prepared to make the  finding that the Defendants could not have completed the validation within such a tight timeframe.

155.The Defendants’ validation can be divided into two parts: (i) the technical validation done to confirm the accuracy and reliability of the markers; and (ii) the clinical validation to confirm the results of the Y-test with reference to the actual clinical results. The first three grounds of challenge relate to technical validation whilst the last ground concerns clinical validation. I will deal with each ground in turn.

D.II.5.1  The complaint that the validation lacked sensitivity or LOD testing

156.The first ground of challenge runs follows. As shown in the Defendants’ promotional pamphlet and accepted by Rhys, the amount of foetal DNA in maternal blood during early pregnancy is extremely low. Thus, for a Y-test to be fit for its purpose, it is necessary for its developers to test and prove that their primers are sensitive enough to detect such extremely small amount of foetal Y-DNA in the clinical samples. Otherwise, as Professor Cheung agreed, there may be false negative results, meaning that a male foetus is regarded as a female.

157.By reference to the Defendants’ technical validation done on 31 August 2012, Rhys alleged that, during the post-hiccup technical validation, the Defendants checked the sensitivity of their primers by testing 100pg and 500pg of male DNA in each reaction respectively. Rhys claimed that 100pg was the LOD, and this was a simplified version of a sensitivity test. However, Diagcor claims that having sensitivity test of only down to 100pg in each reaction is plainly insufficient and unrealistic. Even Professor Cheung accepted that it was unsafe for the Defendants to check sensitivity by testing down to 100pg only in each reaction. Further, the Defendants did check the sensitivity of selected primers (i.e. MK00 and MK03) below 100pg, but they curiously did not do so for the other markers.

158.On the other hand, Professor Cheung said that despite the Defendants only tested 100pg and not lower for most markers, the Defendants’ resulting clinical validation indicated that their markers were sensitive enough to cope with the fetal DNA concentration of maternal blood at 7-8 weeks of gestation. Professor Cheung also suggested that it would have been better if the Defendants had used more blood samples of 7-8 weeks. However, the Defendants had no record of the gestation period of most of the maternal blood samples does not necessarily mean that those samples were not of 7-8 weeks. Though Rhys did skip some of the steps, the final result showed that the Defendants’ disclosed Markers were sensitive enough for detection of blood samples at 7-8 week pregnancy.

159.For myself, I find it strange that Rhys had not adopted the same standard for testing all the markers. However, Mr Ng submits that the document showing the testing of selected markers to lower sensitivity was only dated 25 September 2012 which was after the launch of the Defendants’ Y-Test, and he therefore says that the Defendants might have produced this document for the purpose of promotion to their clients, and this might not represent the actual tests done by the Defendants before the launch of their Y-test.

160.Mr Ng further submits that Diagcor has not pleaded a positive case as to the proper standard for the LOD. In any event, Diagcor similarly did not test for the LOD of their markers and it also only performed tests down to 100pg. However, Mr Lo suggests that there are some documents showing that Rebecca did perform tests lower than 100pg, but she was not given the opportunity of providing further explanation on such matter which is unsatisfactory.

161.Having carefully considered the evidence, I am not prepared to draw any adverse inference against the Defendants’ case by reason of the first ground of complaint. There was no universal standard for conducting technical validation of a Y-test. Even if titration was done only down to 100pg but not lower, clinical validation still showed that Defendants’ Y-Markers could successfully detect fetal DNA at 7-8 weeks pregnancy which was early pregnancy. The fact that the Defendants performed an imperfect technical validation does not mean that they had not done such validation at all. Finally, even that I do not accept Rhys as a reliable witness, I cannot ignore the fact that the testing of MK00 and MK03 to lower sensitivity was done only after the launch of the Y-test as the Defendants’ “Reporting Criteria & Reference” (“RC&R”)[7] was only dated 25 September 2012 which was after launch of the Defendants’ Y-Test.

D.II.5.2  The complaint relating to the setting of Ct cut-off value

162.The second ground to attack the deficiency of the Defendants’ technical validation relates to the setting of Ct cut-off value, which Diagcor complains was unsafe and illogical.

163.The Defendants’ Y-Test uses the RT-PCR to amplify Y-markers. The “Ct value” represents the PCR cycle in which amplified DNA reaches a pre-set threshold. Generally speaking, a lower Ct value indicates a large amount of amplicon, whereas a higher Ct indicates a smaller amount of amplicon. In the context of the Y-test, a Ct cut-off value is set for the purpose of deciding whether the PCR result is a “positive” or “negative” one – if the Ct value for a PCR is below the cut-off, it would be regarded as “positive” (ie. Y detected); if the Ct value is above the cut-off, it would be regarded as “negative” (ie. Y not detected). Given the function of the cut-off to distinguish between a true positive from a false positive, a marker with a Ct value further away from the Ct cut-off would be preferable to one with Ct value closer to the cut-off, as the chance to exceed the Ct cut-off to be “regarded as false positive signal” is lower.

164.The Defendants’ RC&R set the absolute Ct cut-off value at 40 for most MK markers (other than MK00 & MK27). In the Defendants’ Y-Test, for markers other than MK00 and MK03: (i) a Ct value of less than 38 would be regarded as “positive”; (ii) for a Ct value between 38 and 40, the amplification plot would be re-checked; and (iii) for a Ct value of 40 or above, it would be regarded as a “false positive” signal.

165.On the Defendants’ evidence, when setting the Ct cut-off value for the bulk of the Y-markers, the Defendants did not perform any serial dilution for each of them like what they did for MK00 (X) and MK03 (DYS14). According to Mr Lo, if this were the Defendants’ genuine setting of the Ct cut-off value for their MK markers, such failure would have fatally compromised the validity and integrity of the Defendants’ Y-Test.

166.Mr Lo further submits that, on the Defendants’ own validation data, the Defendants had failed to check the sensitivity of their primers below 100pg. According to the Defendants’ data in a document with the title “Class 2i – sensitivity data”, the Ct value of MK16F1 (well G11) for 100pg of male DNA was 39.91, which was virtually on the Ct cut-off (i.e., 40). Even Professor Cheung accepted that if the DNA amount was under 100pg (which would almost certainly be the case using the Defendants’ extraction protocol bearing in mind the low foetal DNA concentration in maternal blood[8]), the Ct value for MK16 would be above 40. In that situation, a genuine positive signal would be wrongly regarded as a false positive one (i.e., negative). The Defendants’ alleged approach of setting the same Ct cut-off value without first carrying out serial dilution for each of the MK markers is plainly unsafe and illogical and does not work in practice. This supports Diagcor’s case that the MK markers under validation were not the ones in fact used in the Defendants’ Y-Test.

167.Again I am not prepared to draw any adverse inference against the Defendants’ case by reason of such complaint.

168.At trial, Mr Lo has not asked Rhys anything relating to the Ct value on RC&R (i.e. 38 Ct value). As Rhys explained to the court, RC&R was only a reporting criteria and reference after launch. It was not the Ct criteria at the development stage. As mentioned above, the court cannot ignore such possibility. According to Rhys as stated in §3.14 of his 1st Affirmation, the cut off Ct value for each marker chosen by the Defendants for the maternal Y-test varied from marker to marker but generally speaking, the value should lie around 30 to 40.

169.At trial, Mr Lo has not showed Professor Cheung the said §3.14 about the Ct value of each marker chosen by Rhys (i.e. lie around 30 to 40). Therefore, I agree with Mr Ng that it would be unsafe to assume that the Ct cut off value was 38 at the stage of development as shown on RC&R and have asked Professor Cheung accordingly. In any event, when being asked whether it was illogical and unsafe to set a cut-off at Ct 38 or checking amp plot at Ct. value 38-40 without doing serial dilution (i.e. LOD), Professor Cheung explained that the cut-off or checking amp plot Ct value at 38-40 was likely based on reading data generated during development. Indeed, “if >=38-40, check amp plot” at the table at RC&R means that the cut-off Ct value is not strictly at 38 but can be at 40. Diagcor fails to show that Ct 38 at RC&R was in fact the Ct value at the stage of development.

D.II.5.3  The complaint about the lack of melt-curve runs

170.Diagcor also complains that, amongst the Defendants’ 28 MK Markers, except for the two directly adopted MK00 (X) and MK03 (DYS14)[9], the Defendants had not performed melt curve analysis to check their specificity. According to Mr Lo, this casts a serious doubt on the genuineness of the Defendants’ purported validation to test their allegedly newly developed markers.

171.Mr Lo submits that it was important to use melt curve analysis to confirm the specificity of the primers. It was also simple, quick and convenient to do such analysis without extra troubles or costs. However, Rhys admitted that only MK00 and MK03 (which he did not design but were adopted from public sources) underwent melt curve analysis, while after the alleged “hiccup” period all other markers allegedly designed by him did not. Rhys considered it unnecessary for three major reasons: (i) female DNA was tested to make sure primers would not cross-react with X-chromosome; (ii) even when primers suffer from non-specific bindings, probes would screen out the non-specific products; and (iii) non-specific primers would only affect the efficiency by delaying the Ct cycles, which can be solved by setting LOD at 15 copies of DNA. If Rhys’ purported reasons were valid, it is inexplicable why MK03 (DYS14 – a Y-marker), would have undergone a melt curve analysis. According to Mr Lo, the fact the Defendants used melt curve to confirm the specificity of MK03 exposes the fallacy of Rhys’ arguments.

172.Mr Lo also argues that none of the explanations given by Rhys is valid:

(i)  For the first explanation, as Professor Cheung conceded, when the primer sequence is not sufficiently unique, the primer may bind to any non-target genomic locations. Primers may also stick onto themselves (i.e., primer-dimers), resulting in self-amplification. When either or both of these non-specific bindings occur, what is amplified is not what is targeted. In Y-Test context, non-specific bindings can still show Ct values, suggesting it is a male result when in fact it is a female.

(ii)  For the second explanation, although Rhys argued that the use of probe can enhance the chance of specific amplification, he agreed that it is only an indirect way and does not check whether primers are specific. Professor Cheung also accepted that probes do not guarantee specificity, because probe also has the problem of non-specific binding.

(iii)  For the third explanation, as explained above, the Defendants’ purported LOD testing down to 100pg (ie. 15 copies) is itself problematic. Apart from this, the Defendants’ reporting criteria itself was unsafe and illogical. Thus, any delay in Ct cycles is liable to lead to a false negative result.

173.Likewise, I will not draw any adverse inference against the Defendants’ case by reason of the third complaint.

174.Both experts agreed that sequencing is the highest standard. Professor Cheung said that even though primers may anneal to non-products, it would be highly unlikely for probes to anneal to non-products, therefore non-specific products would not show in the signals of probes. This means the use of probes enhances specificity. In this regard, Professor So also agreed that the use of probes will enhance specificity. Professor So further agreed that melt curve cannot be performed when using probes. Melt curve can only be performed when using SYBR Green.

175.There is no dispute that both Rebecca and Rhys did not do sequencing. According to Professor Cheung, both gel electrophoresis and melt curves are steps taken after amplification, which cannot confirm if the PCR products are the intended products. Professor Cheung said gel electrophoresis can only see the size of the product whereas melt curve can only see if there is a single product. For confirmation of the identity of the product (i.e. the exact sequence), the only method is to do sequencing. Both parties did not meet the highest standard. Since gel electrophoresis and melt curves cannot confirm the intended products, they are really unnecessary steps. It therefore depends on the independent designers to decide if these idealistic steps should be taken.

176.For these reasons, I do not find that the non-running of melt curve analysis by itself would cast doubt on the credibility of the defence case.

177.Joseph and Professor So also criticised the Defendants in their respective witness statements and expert reports that the Defendants performed only one test run for all the Defendants’ disclosed Markers (i.e. MK00 - MK27). Diagcor also complains that the Defendants did not do optimization. However, since Mr Lo has not relied on these challenges in his final submissions, I do not propose to deal with them in this Judgment. In any event, for the reasons as stated in Mr Ng’s final submissions, I would not draw any adverse inference against the defence case by reason of these attacks.

D.II.5.4  The complaint relating to the deficiency of the clinical validation

178.Having dealt with the challenges against the technical validation, I now turn to the complaint relating to the Defendants’ purported clinical validation of the Defendants’ Y-Test.

179.Mr Lo submits that the Defendants are seeking to rely on the result of the clinical validation to justify the deficiency of the technical validation. Without first establishing the markers’ feasibility (e.g., LOD, specificity) and defining the reporting criteria (e.g., Ct cut-off values) prior to initiating clinical validation, whatever results one may gather from clinical validation simply cannot be used to determine whether the markers are fit for purpose or whether the pre-specified reporting criteria have been met. In other words, this is to put the cart before the horse.

180.In any event, Mr Lo argues that the the Defendants’ clinical validation itself is fraught with the following major loopholes and pitfalls to the extent that the Defendants themselves would not possibly have used the Defendants’ Markers to develop the Y-test:

(i)  With reference to the Defendants’ RC&R, Rhys claimed that MK04 and MK14 were “reserve markers” to enlarge the panel for marginal cases when only 2-3 Y-markers tested positive. Hence, MK04 and MK14 had an important and decisive role in marginal cases, as Professor Cheung agreed. Yet, Rhys conceded that no clinical validation was done for these two markers. Even Professor Cheung found it odd as he considered it necessary to clinically validate these two markers.

(ii)  Rhys’ allegation that certain raw data for clinical validation were lost is incredible. As to the first round of clinical validation, the Defendants produced the raw data for the first 50 samples and a Sample Log purportedly recording the result checking exercise with doctors. Rhys confirmed that the Sample Log was a contemporaneous record made by him before launch of the Defendants’ Y-Test. However, Rhys also said that the raw data for samples nos. 51-55 went “missing” as they were only stored in the demo PCR machine which had been returned. On the Sample Log, there is no record of the “No. of MKs” for samples nos. 51-55, but Rhys claimed that he had looked at the test results for samples nos. 51-55. If these five samples had been tested and Rhys had seen the results, it would not make any sense that he did not record the “No. of MKs” for these samples (cf. Rhys even stated “0” in the “No. of MKs” column for e.g., samples nos. 49, 50, i.e., no Y-markers detected). Regarding the second round of clinical validation, Rhys claimed that the raw data for the alleged 46 samples also went missing. It is improbable that such data would have just gone missing without a trace or cannot be retrieved whatsoever.

(iii)  The Defendants’ pamphlet claimed over 99% accuracy for “7至8孕週起” (starting from 7 to 8 gestational weeks). Amongst the 50 clinical samples with raw data, only 19 were marked with gestational age, while the rest had no gestational information. Rhys admitted that they might well be of 10 or 12 gestational weeks. Among the 19 samples with gestational age, only 12 samples were in 7-8 weeks gestation, of which 7 samples tested as male and 5 tested as female. For the 7 “male” samples, Professor Cheung agreed that their foetal DNA concentrations were unknown and might well have exceeded 100pg (i.e., the Defendants’ tested LOD) such that they were detected by the Defendants’ Markers; and there would be more confidence to interpret these clinical validation data if LOD had been tested down to 28.5pg. For the 5 “female” samples, Professor Cheung also agreed that they were not detected directly but inferred by a negative result for Y-chromosome which could be caused by undetectable levels of male foetal DNA, and this possibility of false negative cannot be ruled out without LOD study down to at least the median concentration. Since only 7 “male” and 5 “female” samples were tested, the sample size was too small. Without doing LOD and specificity properly in the first place, when more samples were tested, one cannot be sure that these false negative and false positive problems may not surface.

181.Foy myself, I find it odd that Rhys had not done any clinical validation in respect of MK04 and MK14 (see: (i) of the preceding paragraph). No satisfactory explanation had been given at the trial. I also find it strange that Rhys had not kept full documentation of the clinical validation as outlined in (ii) of the preceding paragraph. As mentioned in the earlier part of this Judgment, Rhys should have kept proper documentation about the development of the Defendants’ Y-Test in order to fend off the likely challenge by Diagcor about the genuineness of the test. In my judgment, these two observations are additional factors undermining the credibility of the defence case.

182.Professor So also raised some other queries about the clinical validation allegedly done by the Defendants, such as the Defendants had failed to obtained proper consent from the patients concerned in validating the test results of the Defendants’ Y-Test.  Since Mr Lo has not relied on these queries in his final submissions, I do not propose to deal with these challenges against the Defendants’ clinical validation. In any event, this is not a trial on the standard of morality of the Defendants’ clinical validation. Even if the Defendants had not obtained proper consent, it should not affect the court’s finding as to whether the Defendants did carry out the clinical validation as alleged by them.

183.I must emphasize one thing here. Though I am not prepared to rely on most of the complaints relating to technical and clinical validations to discredit the defence case, it does not mean that I have accepted the Defendants’ case on validation as the truth. As I reject the Defendants’ evidence on the independent creation of the Defendants’ Y-Test based on the other grounds, the court can infer that: (i) the Defendants had used the Confidential Information to help them to launch the Defendants’ Y-Test within a short period of time; and (ii) the purported validations allegedly carried out by the Defendants were not genuine. In other words, the alleged validations might not have been carried out. Even if they had been carried out, they were only attempts to conceal the plot of using the Confidential Information to develop the Defendants’ Y-Test.

D.III  The liabilities under the Confidential Information Claim

184.For the reasons above, it is more likely than not that the Defendants’ Y-Test was not a product of independent development but involved copying from the Plaintiff’s Y-Test. In particular, the Plaintiff’s footprint was found in the development of the Defendants’ Test. The full extent of the usage of the Confidential Information may have to be further investigated in the next stage of the proceedings on assessment of damages or inquiry as to account of profit.

185.As I reject the evidence of the Defendants’ witnesses, I have doubt in the whole design process (including the validations) alleged by the Defendants as to how they developed the Defendants’ Y-Test. I also have reservation as to whether the Defendant’s disclosed Markers were indeed the ones used by them in the development process, though this matter may have to be further revisited by the court in the assessment of damages or inquiry as to account of profit stage. However, in opposing Diagcor’s claim for quantum of damages or account of profit, the Defendants are not allowed to run a case which is inconsistent with the findings made by the court in this Judgment.

186.For the sake of completeness, I would like to deal with a pleading point taken by Mr Ng about the so called “smokescreen” theory, ie. the allegation by Diagcor that the Defendants’ disclosed Markers were not indeed the ones used by them in “developing” the Defendants’ Y-Test. Mr Ng argues that Diagcor should not be allowed to run this theory without a proper plea to such effect in the pleading. I disagree. It has all along been the case of Diagcor that the Defendants’ Y-Test was developed using the Plaintiff’s Confidential Information. According to Diagcor, the Defendants’ alleged design process is therefore a story of fabrication. In fact, there has been no misunderstanding between the parties on such issue at the trial, and the Defendants have been given more than adequate opportunity to deal with such allegation at the trial. Hence, there is no substance in such pleading argument.

187.Billy and Rhys admitted to having access to the Plaintiff’s Confidential Information including the markers and their associated primers and probes sequences for the Plaintiff’s Y-Test, in relation to which they owed clear confidentiality obligations. They have become members of the Corporate Defendants, which provided a competitive Y-test as part of the New Business from the start of its operations. Given their roles both in the operation of Diagcor and the New Business, in particular Billy’s unsuccessful and evasive attempt in trying to distance himself from the New Business, I find that both Billy and Rhys are liable for the use of the Confidential Information in the development of the Defendants’ Y-Test.

188.There is no evidence to suggest that Peggy or Terry was involved in the development of the Defendants’ Y-Test. Though they could have gained access to the Confidential Information, there is no basis for the court to infer that they were personally involved in actually gaining access to the Confidential Information or in its use for the development of the Defendants’ Y-Test.

189.Although the Defendants’ Y-Test appeared to have been provided under the name of DNA Laboratory, the alleged designer Rhys was employed by AceCGT Diagnostic. Billy has also accepted that, since the formation of the AceCGT Group, the Corporate Defendants have been functioning as a whole and their employees had the duty to work for other entities in the same Group. Under such circumstances, each of the Corporate Defendants is liable for misusing the Confidential Information for developing and providing the Defendants’ Y-Test.

190.I also agree with Mr Lo that, apart from the said primary liabilities, Billy, Rhys, Peggy, Terry, Alan and the Corporate Defendants were acting in concert to further their common design to misuse the Confidential Information to develop the Defendants’ Y-Test. Based on the evidence in the present case, in particular the circumstances under which they all left Diagcor and joined the competing New Business at more or less the same time, the court has reasons to infer that all of them were part and parcel of the competing New Business.  Further, taking into account that they all joined and participated in the New Business and the Defendants’ Y-Test was launched within a short period of time, the court also has reasons to infer that they knew about and participated in the said common design.

191.Indeed, Terry and Alan provided all the necessary funds to ensure that the common design could be carried out. Terry’s assistance was also significant given his roles in: (i) leasing the office premises; (ii) recruiting the staff members to develop and provide the Defendants’ Y-Test; (iii) procuring and collecting blood samples for the alleged clinical validation; (iv) cross-checking clinical test results; and (v) promoting the Defendants’ Y-Test to medical practitioners and clinics. After all, as Terry and Alan did not have any background in the highly technical bioscience industry, they should not have played such an important part in developing the New Business unless they had been promised the necessary technical “transfer” for the development of the New Business.

192.I therefore find the said Defendants liable for the Confidential Information Claim.

E  THE NEGLIGENCE CLAIM

193.I now address the merits of the Negligence Claim which relates to the Alpha-Test Incident and the Beta-Test Incident. During these two incidents, Diagcor claims that Maggie approved and issued two respective reports containing wrong testing results. According to Diagcor, these have caused Diagcor to suffer a complete loss of test referrals from some medical practitioners.

194.In this connection, Diagcor’s original claim is premised on negligence, wilful default, breach of contract and unlawful interference with Diagcor’s business. In the course of the trial, Diagcor has dropped the wilful default claim.

195.As pointed out by Mr Lo, there is no serious dispute over Maggie’s role in respect of both incidents. At all material times, Maggie was employed by Diagcor as an MLT-I[10] tasked with the responsibility for: (i) reviewing patient test results and draft test reports prepared by subordinate technical staff; and (ii) signing and issuing the final test reports. As admitted by Maggie herself, she acted as the “final gatekeeper” before Diagcor’s test reports were issued, as her signed reports would not be checked by another person before issuing to clients. Accordingly, there is no serious dispute that Maggie was under a duty to excise all reasonable care and skill in reviewing and checking the test results before formally issuing the test reports on Diagcor’s behalf.

196.There is also no dispute that the conclusions stated in the subject reports issued in the Alpha-Test Incident and Beta-Test Incident were erroneous, with both reports misstating that the foetus had not inherited the relevant globin gene mutations when the foetus had. It is therefore Diagcor’s case that Maggie had negligently issued the test reports when the results did not or could not support her conclusions.

197.I then deal with the claims in respect of both incidents in turn.

E.I  The claim in respect of the Alpha-Test Incident

198.On 2 December 2011, Dr Shell Wong (“Dr Wong”) referred Madam A to Diagcor for the Alpha-Test. On the Test Request Form, Dr Wong stated that the foetus’ parents were carriers of Alpha-Thalassemia.

199.On 5 December 2011, Diagcor’s lab technician (MLT-II) Wallace Chan (“Wallace”) carried out testing on Madam A’s sample. He first performed PCR on the sample, and then analysed the PCR product by gel electrophoresis.

200.There should be 4 separate lanes on the gel photo obtained in the test:

(i)  Lane 1 is the DNA ladder, which is a mixture of DNA segments of known sizes which can be used as a reference for estimating the size of any DNA segments in the testing sample. The DNA ladder contains DNA segments of 1000bp, 1200bp, 1500bp, 2000bp and 3000bp in size.

(ii)  Lane 2 is loaded with a negative control sample which does not contain any DNA template. Thus, there should be no observable band on this lane as no DNA material is present.

(iii)  Lane 3 is loaded with positive control mix which contains DNA materials of both normal allele and mutated alleles.

(iv)  Lane 4 is loaded with the PCR product of Madam A’s sample.

201.The expected PCR product sizes for normal allele and mutated alleles are different. The product size for normal allele is 1800 bp, whereas the product sizes for mutated –α3.7 allele, –α4.2 allele and –SEA allele are 2020 bp, 1630 bp and 1350 bp respectively.

202.The analysis of the product size of Madam A’s sample was performed by comparing it with the product sizes on the DNA ladder (lane 1) and the positive control (lane 3). If there is no band near 1800 bp in lane 4, Madam A’s foetus would be alpha-thalassemia positive.

203.In the gel photo obtained from Madam A’s test which is reproduced below (“the Subject Gel Photo”), Diagcor claims that even an untrained eye would see that there is no band anywhere near 1800 bp in lane 4. Instead, there is a single bright and sharp band appearing between 1200 bp and 1500 bp.

204.However, when Wallace first interpreted the Subject Gel Photo, he wrongly stated on the Alpha Thalassaemia Detection Worksheet that the product size of Madam A’s sample was “Homozygous 1.80 (kb) / 1.80 (kb)”, and reached the conclusion that it showed “Normal (Homo)” allele.

205.The Subject Gel Photo, the Detection Worksheet and the draft Screening Report were then passed to Maggie for checking. As the MLT-I, Maggie was responsible for verifying that the test result was correctly interpreted and analysed by her subordinate MLT-II before endorsing her signature on the draft Screening Report. Nevertheless, Maggie failed to identify such mistake made by Wallace and signed on the draft Screening Report with wrong test result, which was then issued to Dr Wong.

206.The mistake was finally revealed on 13 April 2012, when Dr Wong complained to Diagcor about a suspected false negative result for Madam A’s Alpha-Test. Diagcor then re-checked the Subject Gel Photo and found that there was a single bright and sharp band at 1350 bp on lane 4 (i.e. Madam A’s sample), indicating a deleterious mutation of SEA allele at the α-globin gene in both chromosomes of the foetus, so that the foetus was homozygous for Alpha-Thalassemia instead of normal as Maggie purported to report.

207.Diagcor subsequently carried out an internal investigation on the Alpha-Test Incident on or about 16 April 2012. Maggie herself was the investigator. Under the section “Causes of incident” of the Investigation Report, Maggie frankly admitted that they had overlooked the result and concluded that the “false negative result was reported due to human error and carelessness”. Nevertheless, it was also stated in the report that: “[too] much sample and reports may impose certain extend of pressure to the staff, error may occur, the quality of tests are affected.

208.As a result of the Alpha-Test Incident, Diagcor reached a settlement with Madam A whereby Diagcor was required to pay her a sum equivalent to HK$183,150. Further, Diagcor claims that it suffered from a complete loss of test referrals from Dr Wong which amounts to HK$1.7 million per year.

209.In defending the Negligence Claim in respect of the Alpha-Test Incident, Maggie tries to put forward the following arguments:

(i)  Maggie was pregnant with her second child at the time of the Alpha-Test Incident, and her workload was extremely heavy by that time.

(ii)  Diagcor has failed to produce evidence on the standard to be expected from a MLT-I or MLT-II (in particular both experts are not MLT), and so there is no evidence that Maggie’s mistake fell below the standard under the Bolam test.

(iii)  Joseph and Diagcor all along did not consider Maggie to be negligent in respect of the Alpha-Test Incident.

210.In my judgment, none of these grounds can provide Maggie with a complete defence to Diagcor’s claim or a partial defence of contributory negligence.

211.First, pregnancy and heavy workload are not proper defences for a professional to justify such kind of mistake. Further, Maggie had not pleaded these matters as a defence to Diagcor’s claim or to substantiate the defence of contributory negligence. Without such a plea, Diagcor would be deprived of a proper opportunity of adducing evidence to rebut the somewhat vague allegation by Maggie.

212.In the Amended Defence, the Defendants have pleaded some other matters to support the defence of contributory negligence. However, none of these contentions has any merit. The fact that Maggie worked under the MLT Director, Ms Yu Kwai Ying, does not alter the fact that Maggie was the final gate-keeper before issuing the report to client. Further, by pleading that Diagcor had a “deficient test system”, the Defendants had not pleaded or put forward any substance as to what a proper system should be. Hence, Maggie’s contention is nothing more than mere allegation.

213.Second, the mistake made by Maggie was an obvious one.  According to the Test Request Form, both parents of the foetus carried the alpha-thalassemia gene.  As explained by Professor So, if both parents are alpha-carriers, there is a 75% chance that their child would also carry the mutated gene or suffer the disease. When these were put to Maggie, she admitted knowing these matters. As Maggie also admitted, she must exercise care in reporting all samples.

214.As shown in Lane 4 of the Subject Gel Photo, no band was present at 1,800bp position where the normal alpha-globin gene is expected. On the contrary, a bright band (indicating a lot of amplified DNA) was present at around 1,350bp.  Obviously, there was no basis for Maggie to have reported the result as “[n]o deleterious mutation” in the report when there clearly was.

215.Even Maggie admitted that this was an obvious mistake. She also admitted that a MLT-I should have been able to detect such mutation. In view of these admissions and that the mistake was an obvious one, there is no need for Diagcor to adduce further expert evidence from MLT to prove that Maggie’s mistake fell below the standard of ordinary competent MLT exercising reasonable skill and care.

216.Third, the fact that Diagcor did not take any immediate disciplinary action against Maggie cannot assist Maggie’s case. The liability based on negligence is objective. Unless Diagcor had waived such claim against Maggie, which there is no evidence in the present case indicating such waiver, Diagcor can always make such claim against Maggie within the limitation period.

217.At trial, Joseph said that until Maggie’s last day with Diagcor, he considered Maggie a very good technician. He would not have considered making claims of negligence or wilful default but for the fact that Maggie subsequently joined the Defendants. Mr Ng submits that these show that Joseph himself did not believe there was negligence on the part of Maggie. I disagree. Diagcor did make compensation to Madam A for the mistake made in the Alpha-Test Incident. The fact that Diagcor did not by then take action against Maggie cannot amount to a waiver which provides her with a defence to the negligence claim based on the Alpha-Test Incident.

E.II  The claim in respect of the Beta-Test Incident

218.The Beta-Test Incident occurred in May 2012. It concerned Maggie who signed and issued a report on the Beta-Test for one Madam B who was a patient referred by Dr Belinda Leung (“Dr Leung”) on 7 May 2012.

219.Diagcor’s Beta-Test involves analysis of the DNA sequence at 21 most-common mutation sites on beta-globin genes, which are identified from the sample-of-interest by DNA sequencing. The testing process includes the following steps:

(i)  isolation of foetal DNA from patient mother’s antibiotic fluid or chorionic villi sample, followed by purification;

(ii)  PCR amplification of the beta-globin gene in foetal DNA with primers designed to target the relevant gene segment;

(iii)  sequencing of the amplified PCR product to determine the sequence of nucleotides using four colours to denote each base type (i.e., A, C, G, T);

(iv)  analysis of sequencing data of the sample by comparison with the wildtype beta-globin gene sequence; and

(v)  issuance of test report when the presence or absence of any mutations are cleared. In case of doubt, the above process is repeated.

220.According to Madam B’s Test Referral Form submitted by Dr Leung, both Madam B and her husband were carriers of beta-thalassemia thereby increasing the risk of their baby inheriting the mutated genes.

221.Maggie’s subordinate technician, Ms Venus Lee (“Venus”), an MLT-II, extracted and purified foetal DNA from Madam B’s sample, performed PCR amplification, and sequenced the amplified PCR product. Venus interpreted the raw data and prepared a “Beta-Thalassaemia DNA Sequencing Result Analysis Worksheet V2.0”. She marked “D (Hetero)” for the mutation “Codon 71/72 ins A”, and “ND” (which is defined to mean “Not Detected”) for all other mutations. This suggests that only one mutation was found, and the mutation manifested itself by way of an abnormal insertion of a nucleotide “A” in between codons 71 and 72 of the beta-globin gene in one of the chromosomes. On such interpretation, no other mutation was detected.

222.Venus then prepared the draft “Beta-Thalassemia Mutation Screening Report”, which likewise concluded that there was only one mutation by way of an “A” insertion in codon 71/72 at the beta-globin gene in one of the two chromosomes, and suggested that Madam B’s foetus was heterozygous for beta-thalassemia with the genotype (ß0ß).

223.The sequencing raw data, the worksheet and the draft report were passed to Maggie for verification and approval. Maggie endorsed the raw data, the worksheet and the draft report with her signature. The report was then issued to Dr Leung.

224.The conclusion endorsed by Maggie was wrong, as it failed to record one additional mutation for Madam B’s foetus at the location of 28 bp upstream of the TATA box. That is one of the most common mutation sites for the disease found in Chinese. This additional mutation is known as “TATA box nt -28 A➜G”, which is one of the 21 mutations sites to be specifically tested.

225.To interpret the Beta-Test result, one reviews the DNA sequencing result of the patient sample to read off the sequence at the relevant location on the sequencing chromatogram. The chromatogram extract showing the mutation location “(4) TATA box nt -28 A➜G” is reproduced below (“the Extract”). The bottom figure is an extract of the actual chromatogram. The top figure is a drawing representation of the relevant location prepared by the Defendants. The location is surrounded by a rectangle with a hollow arrow pointing to it.

226.On 8 June 2012, Diagcor’s R&D team used Madam B’s sample to test one of its products known as “Beta-Thalassemia Diagnostics Mutation Kit” using the “Dot Blot Analysis”. It revealed that Madam B’s foetus also had the additional “TATA box nt -28 A➜G” mutation.

227.In light of R&D team’s discovery, on 9 June 2012, Constance was instructed to double-check the sequencing raw data as previously reviewed and endorsed by Maggie. Constance confirmed that the additional “TATA box nt -28 A➜G” mutation was overlooked. Thereafter, she sent a revised report to Dr Leung stating that Madam B’s foetus was double heterozygous for beta-thalassemia with the genotype (ß+ß0). Hence, unlike the Alpha-Test Incident, the mistake was discovered by Diagcor itself after the running of a different test on the same sample.

228.According to Diagcor, it suffered a complete loss of referrals from Dr Leung and other medical practitioners as a result of the issue of the first wrong report endorsed by Maggie.

229.This claim is about the interpretation of the data in the Extract. As shown in the Extract, the sequencing data show two peaks, a more “pointed” one at the top and a “broader” peak at the bottom. There is no dispute that the top peak represents an “A” based. As Maggie testified, she regarded the bottom peak as “noise” signal (rather than a “G” base), as the computer sequencing software also reported the location as an “A” base.

230.When being cross-examined, Maggie accepted that her assessment of the bottom peak as “noise” turned out to be wrong. But she insisted that it was her genuine judgment by that time that the bottom peak was a “noise”, and that she could rely on the computer software’s assessment of an “A” at that location. She had no suspicion of the result at the time. This was why – even though she accepted that she could have checked the results more clearly had she enlarged the chromogram on the computer – she did not bother to do so.

231.Diagcor, very fairly, is not suggesting that Maggie should have positively picked up the “G” peak (ie. indicating a mutation) at the relevant location. This would be unrealistic given the presence of a “noise” signal obscuring the location where the “G” mutation might or might not be seen. Instead, Diagcor’s case is that Maggie should not have gone ahead and issued the Beta-Test report given the undisputed presence of a “noise” signal obscuring a proper assessment of the mutation site. As Diagcor has pleaded, “it [was] the duty of [Maggie] to re-test the sample to clarify whether those observable peaks arose from a mutation [or] a background signal/no[i]se”.

232.Mr Lo relies on the common consensus of the experts that a re-run of the test was required in view of the undisputed presence of the “noise”. Mr Lo submits that this is common sense: when a noise is blocking Maggie to check whether a “G” mutation is present at the location, the only sensible thing to do is to re-run the test. It has been established at trial – both from the experts and Maggie herself – that re-running the DNA sequencing, especially from an opposite direction, could have resolved the issue and allowed Maggie to have a look at the location more clearly.

233.Maggie’s explanation for not arranging a re-run of the DNA sequencing were: (i) she had “no doubt” that the noise signal was a true noise – implying that the noise signal was not obscuring any mutation; and (ii) she was justified to rely on the reporting software’s assessment of “A” at the location.

234.It is clear that the “mistake” made by Maggie in the Beta-Test Incident was not that obvious as compared with that made in the Alpha-Test Incident. It is also clear that:

(i)  Constance confirmed that Maggie’s Beta-Test was done wrongly after Constance reviewed the test upon knowing the result of R&D Departments’ Dot Blot analysis. Constance confirmed the mistake in hindsight after research had been done in a totally different test.

(ii)  After the discovery of the Beta-Test Incident, Diagcor adopted various rectification measures including putting in place a new set of primers and introducing a new set of internal guidelines.

235.Having carefully considered the evidence, in particular the matters raised in the preceding paragraph, I have doubt as to whether the “mistake” made by Maggie fell below the standard expected from an ordinary competent MLT-I exercising reasonable and ordinary care and skill. I agree that in many other cases, it may not be necessary for the claimant to adduce expert evidence from the expert in the same field to prove negligence against a defendant, but this is a case involving highly technical matters and interpretation of the Extract which contains some ambiguity. Without knowing the proper protocol as to how an ordinary competent MLT-I would have handled the same situation, Diagcor has failed in its duty to prove the negligence claim against Maggie in respect of the Beta-Test Incident.

236.For the above reasons, I only find in favour of Diagcor in respect of the negligence claim against Maggie concerning the Alpha-Test Incident but not the Beta-Test Incident. As there was an implied term in the employment contract between Diagcor and Maggie that the latter had to exercise reasonable care and duty in performing her work, Maggie was also in breach of such implied term in the employment contract relating to the Alpha-Test Incident.

F.  CONCLUSIONS AND OTHER CONSEQUENTIAL MATTERS

237.I therefore grant judgment on liability against all the Defendants except the 3rd and 5th Defendants on the Confidential Information Claim. I also grant judgment in favour of the Plaintiff against the 3rd Defendant on the Negligence Claim in respect of the Alpha-Test Incident and dismiss the Negligence Claim concerning the Beta-Test Incident.

238.The parties are directed to submit the agreed draft judgment to the court for approval within 21 days. In the case of disagreement, the parties are at liberty to restore the case for further argument on the wording of the judgment.

239.The Plaintiff succeeds in the Confidential Information Claim. It also has partial success on the Negligence Claim. On the other hand, the Defendants succeed in the Negligence Claim in respect of the Beta-Test Incident. In the course of the trial, the Plaintiff has also abandoned the following claims: (i) the copyright infringement claim against the Defendants; (ii) the claim for wilful default against Maggie; (iii) the claim for breach of confidence against Tang in relation to Diagcor’s list of clientele and contacts details of source of referrals; (iv) the claim for procurement of breach of contract by Billy, Peggy, Terry and Alan; (v) the claim for solicitation of Diagcor’s former employees against Billy and Peggy; and (vi) the claim for conspiracy to injure against the Defendants. As it would be very difficult to assess the costs for each respective claims, I would adopt a broad brush approach in making a costs order nisi that all the Defendants other than the 5th Defendant do pay to the Plaintiff 75% of its costs of the whole action with certificate for 2 counsel. The order nisi shall be made absolute 21 days after the date of the handing down of this Judgment.

  (David Lok)
Judge of the Court of First Instance
High Court

Mr Benny Lo, Mr Victor Chan and Mr Clark Yan, instructed by Pang, Wan & Choi, for the Plaintiff

Mr Stanley Ng and Ms Tiffany Tse, instructed by WTS Lawyers, for the 1st to 11th Defendants

Annex 1 – List of the Plaintiff’s Markers

The Plaintiff’s Y-Marker Start location on Y-chromosomes End location on Y-chromosomes Marker Size (bp)
FM01 21730223 21730349 127
FM02 21938383 21938493 111
FM03 21733092 21733212 121
FM04 21917274 21917382 109
FM05
(SRY)
2655270 2655404 135
FM06 19179403 19179510 108
FM07 15018407 15018546 140
FM08 21764618 21764745 128
FM09
(SRY)
2655566 2655690 125
FM10 21717148 21717275 128
FM11
(DAZ)
25380562 25380628 67
FM12
(DYS14)
6114785 6114868 84
FM13 19349574 19349713 140
FM14 21730210 21730353 144
FM15 22739343 22739416 74

Annex 2 – List of the Defendants’ Markers

The Defendants’ Y-Marker Start location on Y-chromosomes End location on Y-chromosomes Marker Size (bp)
The Defendants’ Y-markers allegedly in actual use & reserve
MK01
(SRY)
2655119 2655182 64
MK02 2828181 2828246 66
MK03
(DYS14)
6114785 6114868 84
MK04 7546640 7546695 56
MK05 8467275 8467340 66
MK07 13992213 13992286 74
MK09 14432886 14432953 68
MK14 21717173 21717248 76
MK16 21730224 21730302 79
MK18 21762668 21762751 84
MK21 21894036 21894111 76
MK22 21938361 21938436 76
MK23 22739277 22739355 79
MK24 22749781 22749862 82
MK25 22750916 22750996 81
MK26 23550902 23550982 81
MK27
(DAZ)
25380562 25380628 67
The Defendants’ Y-markers allegedly in development phase but not in use
MK06 8685147 8685209 63
MK08 14001040 14001134 95
MK10 14954272 14954365 94
MK11 15437506 15437606 101
MK12 15581961 15582049 89
MK13 15999198 15999278 81
MK15 21730223 21730349 127
MK17 21733106 21733177 72
MK19 21764381 21764465 85
MK20 21764660 21764737 78


[1]  Order of Au-Yeung J on 12 August 2015

[2]  see the documents listed as Class 2 in the order of Au-Yeung J dated 12 August 2015

[3]  see Section D.II.4 below

[4]  [2011] EWCA Civ 424, §20

[5]  Exhibits D-5 & D-6

[6]  see Exhibit P-6

[7]  which shows the testing of MK00 and MK03 to lower sensitivity

[8]  see Exhibit P-7

[9]  although the Defendants’ validation data in wells 16 & 17 seems to suggest that MK04 also underwent melt curve analysis, this was not featured or confirmed in the Defendants’ testimony

[10]  which is regulated under the Allied Health Professions Ordinance (Cap 359)